header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16583
Transcript Name: prkra-202
Previous Names: prkra-002, zgc:162619-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036033|OTTDARG00000026966|ZDB-GENE-050309-206 prkra|OTTDARP00000028909 CH73-57B20.1-002 LG_ FP102120.9 Danio rerio protein_coding KNOWN, 934 bp
AATCTATTAAAAAGCGGCAGACGGGCAGAAGTAATGGCTG
ATTCAAATGTCACAATGGCTCCCCAACGCAGTCAGGACAA
AACACCGATCCAGCTCCTGCACGAATATGGCATTAAAATC
AGCAGCGCGCCGAAATACGAGCTCATTCACGCGGACGGGG
ACGCGCATCAGCCTTCCTTCATGTTCAGCGTCACCATAGG
AGAGGTCACATGCAAAGGCCGAGGATCCACAAAAAAGGCC
GCGAAGCATGAAGCTGCAGAAGCCGCCTTGAAGTTGCTGA
AGCGAGACAGTCAGATAATAGACCAGAGAGACAACAATGG
TCTATCTCCTGAAGCCGGAGAAGCGTCCAATCCTGTGGGA
ATACTGCAGGAGCTGGCCATGCAGAGAGTGTGGTGTCTGC
CCGAGTATGTTGTGTTTATGGAGACTGGGCCGGGACACAT
GAAGGAGTTCACCATCGCCTGCCGTCTGGAGGGACTGGAG
GAAACAGGATCCGGCAGCTCCAAAAAGCTGGCCAGACGAG
CAGCTGCTGAAAACATGATCGCCAAACTGCAGAGTTTGTC
AGGATCTTCTGAGATCACGTGGAGTCCTCCTTCTCGTGTG
TATGTGGAAAGCTTGCGTAATTCCACTGGTGAGAAGGTCT
CGCTGCTGAAGAGGACGCCGCTCAGCCTCCCAAACACAGA
CTACATTCAGATGCTGCTGGAGATCTCACTGGAGCTCGGC
TTCCAGGTCACATACATCGACATTGATGAGCTGACAGTGA
ACGGTCAGTATCAGTGTCTGGTGGAGCTCTCCACCCGGCC
GGTGACGGTGTGTCATGGCTCTGGAGTGACCAGCAGTAAC
GCCCACAACGCCGCAGCCCACAATGCACTGCAGTACATCA
AGATGGTGGCCAGCAAACACTAACAGCAGGTCTGGGGTCT
GCAAACGCACGCTG

prkra TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA prkra-201 (1)    Ensembl 1596
prkra-202 934
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prkra-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036033 (1),  Ensembl_Trans:ENSDART00000140917 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH502132 (1) 957 bp
GenBank:CO919316 (1) 808 bp
GenBank:EB769436 (1) 630 bp
CITATIONS (2)