ZFIN ID: ZDB-TSCRIPT-090929-16541
Transcript Name: loxl2b-202
Previous Name: loxl2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035990 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035990|OTTDARG00000026943|ZDB-GENE-050208-29 loxl2b|OTTDARP00000028873 loxl2b-001 LG_none BX323062.10,CT990639.10 Danio rerio protein_coding KNOWN, 3555 bp
AGTGAAAGTTTAGGGGATGAGCAACAGCCTAGAGAAGCAG
GGATTTACACTTCGGAGGAGTATTCTACTGTGAAATTTGC
ACTCGCAGCAAAAGGCCATACAATCTGAGCCTCTGTCATT
ATGCTGGCTCTCTGGTCTATATCATTTGTACTATTGTGCT
CTTGGAGGCTAAGCTACGCACAGTATGAGCACTTGGGTTT
TGCTATAGCCTACCAGGAGCCTGAACAAGACCTTTACACT
CCTCCAGAGCTTCCTGCAGATACTCCCAGGATACAGTTAC
GTCTGGCAGGAGAGAAGCGCAAGCACAATGAAGGGCGCGT
TGAGGTCTTCTATGAAGGGGAGTGGGGGACTGTATGTGAT
GATGATTTCACCATTCATGCAGCCCAAGTCATATGCAGAG
AGCTGGGCTATTTTGAAGCAATATCCTGGTCTCCATCATC
TAAATATGGCAAGGGAGAAGGTCGTATCTGGTTCGATAAC
GTCCACTGTAAGGGAAAGGAGAAGAGCTTGGCTCAGTGCG
AGTCTAATGGCATTGGTGTGTCTGATTGCAAACATTCTGA
GGATGTCGGGGTCGTTTGCAGTGACAAGAGAATCCCAGGA
TTCAAGTTTGTCAACACCCTTACCAACAACATCAATAGTC
TGAACATTCAGGTGGAGGATGTTCGTATCCGCCCTATCCT
GGCATCATATCGGAAGCGCATCCCAGTGACAGAAGGCTAC
GTGGAGGTGAAGGATGGAGGAAAGTGGAAGCAGATCTGTG
ATGATGAGTGGACTCAGATGAACAGCAGGGTCATCTGTGG
CATGTTTGGCTTTCCGGGACAGAAAAGATACAATACCCGG
GTGTACAAGATGTTTGCCCGCAGGAGAAAGCCATCATACT
GGGATTATACCATAAACTGTACTGGAAAGGAAGCTCATTT
GTCTAGCTGTACGCTGGGCCACACGCTCAGCAACAGCACA
TGTGAGGAGGGCACACCGGTGGTAGTCAGCTGCATCCCTG
GCAGAGCATTTGCCCCGACTCCCATGACGGGATACAAGAA
AGCCTTCAGACAGGAGCAACCCCTGGTGCGTCTCAGAGGT
GGTGCTGTTGTTGGAGAGGGGCGCGTGGAGGTCTTGAAGA
ATGGAGAATGGGGCACAATCTGTGATGACAACTGGAATCT
GCTAGCAGCTACTGTCGTGTGTCGTGAGCTTGGATTCGGA
AGTGCCAAGGAGGCTCTTTCTGGAGGTCAGCTTGGACAAG
GAATGGGCCCTGTACATATGAATGAAGTTCAGTGTTCTGG
CTTCGAGAAGTCTGTCACTGAGTGCTCCTTCAATATGGAA
AAAGACTCTGAAGGCTGCAGTCATGAAGAAGACGCAGGTG
TTAAGTGCAATGTTCCTGCTATGGGCTTCCAGCAAAGGCT
ACGGTTGAGCGGAGGTCGTAACCCCTTTGAAGGTCGTGTT
GAGGTTCTTGTGGAGCGCAATGGTTCTCTTGTTTGGGGGA
CTGTCTGCGGTGAGGGGTGGACAACAATGGAGGCCATGGT
GGTCTGCCGACAGCTTGGACTGGGATTCGCTAGCAATGCT
TTCCAGGAGACGTGGTACTGGCCTGGTGCAGTGAATGCAG
ATGCAGTGGTTATGAGTGGAGTGAGGTGTGCAGGAACAGA
GATGTCTCTCTCCCACTGTCTGCATCACGGAGAATATCTC
AGCTGTCCTAAAGGTGGAGGACGATTCGCTGCTGGAGTTT
CCTGCTCAGAGACTGCTCCAGATCTGGTGCTCAACCCGCA
GGTGGTGGAACAGACCACATATTTGGAGGACCGTCCTATG
TTCATGTTACAGTGTGCTTATGAGGAGAACTGCCTGGCCA
GCACCTCCAGTGCCACTCCTGCCAACTCCCCTCGCCGGCT
CCTCCGTTTCTCCTCCCAGATCCACAACAACGGACAATCT
GACTTCAGGCCCAAAATCTCCAGAGAGAACTGGGTTTGGC
ATGACTGTCACAGGCACTATCATAGCATGGAAGTGTTCAC
CCATTATGATCTACTCAGCACCAATGGCACTAAGGTTGCA
GAAGGACACAAAGCAAGCTTCTGTCTGGAGGACTCAGAGT
GTGATGAAGGAATTGAAAAGAGGTACGAGTGTGCGAACTT
TGGTGAGCAGGGCATCACAGTGGGCTGCTGGGATACATAC
AGACATGACATTGATTGCCAGTGGGTGGACATTACAGATG
TTAAACCGGGAGACTACATATTCCAGATCGTAATTAACCC
CAATTATGAAGTTGCTGAGTCGGATTACACCAATAACATT
GTGAAGTGCAGATGCCGGTATGATGGTCACCGTATATGGA
TGTATAATTGCCATATAGGAGGCTCCTTTAGTGCAGAGAC
AGAAGACACTTTCCCTGGCCTGATCAACAACCAGGTGACC
CACAGGTAAAGGTTCAGATGAACATCCAGAAACCCCAACC
AACCAATGAGATTATCAAGAGCCCTGAACCACTACACCTC
TCTAGAGGACCTTTCCACTTCTCAGCCTTATCTCCATCGT
ACTGTAAGACAGAACAGAACATCCCCATTTCAAACGCATT
CCAGTTTCGAGACAGGAACTGACTCTTGTCTGAGATTAAC
AGACTGAAAAGCTGTTGTTTTCCCTCTCACCCCTGAGGCA
GTAACAAATCTGAAAGCTCAGTCTTTCTGTTTTTGCTGCC
GATGTTGAAAATGGAACTGTGGATAACTCTCAAGTGAGAT
CATTTCTTACATGAAAGGAACTCTGGTGCACTTTTATATA
CATGTGTGTATTTTTGAACTTGACAGGACTTGTGGTTTAG
GTCTTTTTGTAAGCGTTTCAACAAGGTAAGAGGACTTTCC
TCAGGTGGGTCATACATCTACAGAAAAATAAAGGCCTGAA
GAGACCATTTCATTTCCCTTTTTAGTCTCTTATGTGTTTT
AACTTTATACTTGGGCTTTTTGAATCCAAGCTGACGACTT
CTGCTTATAGATAATATTTGAAGTGCCTCATGGGTTTGCA
GTACAAACTGCTGATACATTAAGATACGATGAGCCCTGGA
ATATTTCATCTTTATTTTTTAAAAGGAGTTTGTTCTTACA
TTATGTATTGTAATACAGGAATACTTTGAGAAGCCTTACA
TCTACAGGTTCAGATCAGAGGTTCATAAACACTGGCATCC
CAGGAGCAGGTTACTTTTATTACAGTTTCCCCTGTTTCAT
TATTTGAAATTGACTGGTGGTCAGTTGCTGTGGACAGTCA
TTATGAATTATTTATGCCGTCCATTCTGTACGTCTTATGA
AGCTGACTGAAAACATCACAAGCAAGCATTTAAAGCAATT
TATCACACCAGTATTAAATAACTTATTTAAAAACAGGGAT
TTCTAATGCTATTTTTTTCAATGTGGAATGTTTTTGATTT
GTTGTCTGTCAATGGTGCTAACGTAGTGTTATCCTCTGTT
TTTTGAGGGACTGTATCAGCTAATTTTATATAAAGCTTAC
TTGAATGGATGTAAAAATCATGGATGTATGCAATGTAGCA
TAATAAACATGCATTATTTGGCAAAAGAAGAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
loxl2b-202 Contained in:
[BAC] CH73-202K21 (1), DKEYP-38H2 (1)

Genome Resources: Vega_Trans:OTTDART00000035990 (1),  Ensembl_Trans:ENSDART00000144013 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC129226 (1) 2950 nt
GenBank:CT695453 (1) 789 nt
GenBank:EB779028 (1) 133 nt
CITATIONS (2)