header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16454
Transcript Name: si:ch211-218o21.4-202
Previous Name: si:ch211-218o21.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035898 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035898|OTTDARG00000026884|ZDB-GENE-081104-178 si:ch211-218o21.4|OTTDARP00000028797 CH211-218O21.4-001 LG_ BX537348.8 Danio rerio protein_coding NOVEL, 1189 bp
ACTAAAACCTAAGCAAAAAACAAACAAACGTGTATGTTTT
GTTGAAATATTGGGTACAAAACATTGCTCCTCAGTACCAT
CAGCCAGGGTTTCCAGCTTTCTTCAAAATATCTTATTTTG
TGTTCAATAACAGAATAAAGATAAGAAACACGAGAAGAGC
AAGTGCTGATAAAACTTTAAATTTGGGGTGAACTATCCCT
TTAATGTGAAGAAAATGTGGGGCTAGGATTGGAAGCCGTT
TGATTTCTCGCACGCTTACTGCCCCCAAGCGGTGACTAAG
TGAAATGCGATACAGCACCTTTCTCAGGTGTCCACCGCCG
TGTTGAGAGGTAAACAGATATCTGACTCATACTCACGCCG
CTGCTCAGAAGAGACCTCGCTCATGGAGCCCTGACACACT
TTCGTTTCCCAGCATGCAGCAGGAGCTTTGGCTGAGGGCC
CTTCCTGATACCTGCGTGTGCGATGAGATCAGCCGCTGCA
CAATCACTCCCGATAAGACCAACCGAGCAAGAACTGAAAA
ATGCCATATCCAACAGCATCGCCGGACACAACCACGTCTC
CAGCAGACCAGCACAGCCTCGAGCCAAGTCCACCTCAGAC
ACAGTTCATTGCGGTTCTTTGCATCATCATGGCCATAATC
GAGAAAATGCAGATAAATGTGATACTGCCGAGGGTCCCTG
GAACCTGAACAACCCAGTGAAAGCCTCGAGGAGCCACCAG
GAGCTTCACAAAGAGCTGTTACTGGCCCACAGAAAGCGGG
ACAGAGGGCTGGTGGTGTGTGCTAAGCCAGAGCTTCAGAT
GGTCCTGGAGAGGAGGAAGAGAGAGAAGACGCAGAAGGAA
GAGGGCGAGCAGAGCAGGAGTCCTCTGGAGCAGGTGCTTC
TCCAACGCCAGCAGAAGCATCAGGAGATGATGAAGGAGAA
GGAAGAGGAGCAGAAGGTACGCGAGGAGGTTCAGCTTTTG
GAGTTTGTGCGAGTGCGGCAGAACTTGAAGAAAGTCCACA
CGGCTCTACAGAAGAACATTCACTCCTGAAGCAGATCATC
TGACTAAAGCAAACTTTATTTGGCCATCCAGTTTCATTGT
GAAATAAAGCACACGGTGATGCGTTGAAACAATCCTGTTA
TTAATTCTTTTCATACATTTTATCCGGTTGAACATCATGT
TAATAGTCCATTTTAGACGTTGTTCTAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-218o21.4-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000035898 (1),  Ensembl_Trans:ENSDART00000135155 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CV485053 (1) 777 bp
GenBank:CV485056 (1) 775 bp
GenBank:CD583648 (1) 500 bp
CITATIONS (2)