Transcript

htr1aa-201

ID
ZDB-TSCRIPT-090929-16419
Name
htr1aa-201
Previous Names
  • htr1a-001
  • htr1aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035842 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035842|OTTDARG00000026855|ZDB-GENE-071203-1 htr1aa|OTTDARP00000028750 DKEY-250L23.5-001 LG_ BX571721.8 Danio rerio protein_coding NOVEL, 1786 bp
AATGATCGCAGCTCGAGCGCGCGGCACTTCCTGAGCCCGG
AGCCCGCCATGCGTCTTCAGAGCAGCGAGGTGACCGGCGC
GAGGAGCTGCTTCTGACTCACCATGGAGAGCTACAACAAC
ACCACAGAAAGCCAAGATTGGAGCGGGAACGCGACGAGTG
TCAGCGAAGTTGCTCTGAGTTACCAAATCATCGGCTCGCT
TTTCCTGGCCGCGTTAATTCTGTTTGCCATTTTGGGAAAC
GCGTGTGTCATCGCTGCTATCGCCTTGGAGAGATCGCTTC
AGAATGTGGCCAACTATCTCATCGGCTCCCTGGCCGTTAC
AGACCTTATGGTGTCGGTGCTGGTGCTCCCCATGGCAGCC
CTGTATCAGGTTTTGAATAAATGGACTTTGGGACAGGAGA
TGTGCGATATTTTCATCTCTCTAGACGTGCTGTGCTGCAC
TTCTTCCATCCTGCACCTGTGCGCAATCGCTTTGGATAGG
TACTGGGCCATCACCGATCCCATAGACTACGTGAATAAAA
GGACGCCCAGACGAGCTGCTATCTTGATCAGTCTCACTTG
GCTAATAGGATTTTCCATTTCCATTCCGCCCATGTTGGGT
TGGAGGAAACCGGAGGACCGGGCAGATCCCGACGCGTGCA
CAATCAGCCAGGACCACGGGTACACCATCTACTCAACTTT
CGGGGCGTTCTACATCCCGCTCATCCTCATGCTGGTCCTT
TACGGACGGATATTCCGAGCGGCGAGGTTTCGCATAAGGA
AAACGGTAAAGAAAACGGAGAAAGCGAAAATCGCGGATAA
ATGCTTGGCGGTGTCTCCAGCGCTCTTCCCGAGGAAAGCG
AACGGAGAGGTGGGTAAAACTTGGAGGCGAAGCGTGGAGC
CGTGCGCAAACGGCGCGCTGAAAAACTCGGACGACGGAGA
GTCGTTCGAGATTACAGAAGTTCAAAGCATCTCCAAAAAT
CACCTGAGCCTGCCAAACAACCCTCAGCCGTGCTTCGAGA
ACCGAAATGAGAAAAACACGGAAGCGAAGCGCAAAGTGGC
TCTGGCCAGAGAACGCAAAACAGTCAAGACTCTGGGAATA
ATCATGGGCACGTTTATTTTCTGCTGGCTGCCCTTCTTCA
TCGTAGCGCTCGTGTTGCCTTTTTGTCAGGACTGTTTTAT
GCCCGAATGGTTGGGCGCTGTCATAAACTGGCTCGGATAC
TCCAACTCACTTTTGAATCCTGTCATATATGCGTACTTCA
ATAAAGACTTTCAGAACGCATTCAAGAAGATTTTGAAATG
CAAATGTATTAGACAGTGAACCAAGTCAATCAGCGGGTGT
TCATGTGCAGATATTGATTGTTAAAGATTGCTCTAAAGGC
ATTTACAAAGATGGGACTCAGAGCAGAGCAGAGCAGCACA
AGAGGAGGTAGCGCTCTGTCCTTGTGTCTTTGTTTATCTG
TGAAGTTTATCTGCTTCCATCACATAACAATGTGCATATA
CCATTGGATGGATTCAGATTAGACCAGAACTCTCAGACCA
GCTGCGATCGCGCATTCAACAATAAAGCCCTTAAATAAAC
AAACAAAAAAATTGTTTTAATGTACAGGACGAAAGGCACC
TTTCTCCGAGCAAGGAGCTGTTGGTGGGATTGTAAGCACA
CAAAGACAGAGTTCCAGCAGATAATCTATGTAGAGAAAAT
GTAATGTGAACTCATTAATCTTCATTTTTATTTATTTTCA
GCAGAGATTTCTTATATGACATGGACTGACTGGAATACCT
TGAAATAAAAGATGAATCTAGATCAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations