ZFIN ID: ZDB-TSCRIPT-090929-16418
Transcript Name: lmod1a-201
Previous Names: lmod1a-001, si:dkey-193l3.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035841 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035841|OTTDARG00000026854|ZDB-GENE-081104-348 lmod1a|OTTDARP00000028749 DKEY-193L3.5-001 LG_ BX664742.15 Danio rerio protein_coding NOVEL, 2610 bp
ATGTCCAGACGCACGGCCCGGGAGCGACAGGAGAGCGATG
ATGACTCGGACACAGACCTGCTGCTCGCGGCGCTTTCGCC
GGAGGAAGTGGAGAAGCTCGAGCGTGAACTCGTTTATATC
GACCCCGACCCGACAGTACCTGTGGGACTCCGCCAGAGGA
ACCAGACGGACAAACTCCCGTCCAGAGGATATGACAGAGA
AGCGATGCTAGACTACTGCGAGCGCCAAACCAAGAAACTG
ATCCGGAGAGAACTGAGCGCAGAGGGAGGGGATGGAAGAA
GGAGAGAGCGACTTCGCCGGATGAGGAGCAGAGAGTTTTC
CAGATCACAGAGCGGCGATCCTCCGGACACAGAGAGCAGA
AATGCTGAAAGTGAAAAAGATAAGGAGAGAACGAGAAAAT
GGGAGGATGACTCTAAAGATTTATCTGATGAGGGAAAGAA
TAAACGGGAGGAAAAGAGAACAGGTGATAAGATGGAAAGT
GGCAAAGAACTTTCTAGGAAAGAGAAAGGTGGCAGCAAAA
CTCTAGACCTCATCTCCAAACTGCAAGAGAAACAAGAGGA
GAAGAAAGACAGAGGGAGGAAGGATGACAAGAAAGTGAAC
GAAAACTCCAAAATACGAGGGGTTGTCTCCAAACTTCAGG
GGAATAAAGTGACTGAGGAAAAAAAGGACAAAAAGACGGA
CGTCAAACAGCAAGATGGAAGCAGAACTAAAGCTTCAGAG
GTACCCAAAAACAACAAAGCAGGACGAGTAAACTTAATAG
ATGCAGAAAAAGACGACAAAAACAGCAGATTTAGTACAGT
TGAAGAAACAAGTTTGGATAAAACCAGACCTCAAAAGGAG
AGAGAACAAGTGAAAGCACCAGAAAACAGCAAGGCCAAGA
TTTTTACCAGTTCTTTCCATGAAAGCTCAGGGAACTGTCA
TGGAGCGGACACCTGTTCACTTACTACTGAGGAGGATGAG
TCTTATAGTGAAGATCTGGACAGTGACACTGGCTCCAGCA
TGTTTGACGATCTTCTAGAGCAGGTTCGCAGTGACGATCC
TGAACTAACTGAGGTCAACGTCAACAATTCAGATGCCATT
AAAACAGATACCCTGATTCAGTTTGCAGAGGGTCTTCGCA
GTAACACTCACATCAAAACCTTCTGCCTTGCAAACACAAG
AGCGGATGATCATGTCGCATTCGCCATCGCTAAAACATTG
CGAGAAAACTCAACCCTGACCGGCATCAACCTCGACTCTA
ATCATCTGACAGGCAAGGGCATCCTGGCCATCATCAACTC
TCTTCAACACAACAGCGCACTGATGGAGCTGAGGTTTCAT
AACCAGAGACACATCTGCGGAGGGAAGACTGAGATGGAGA
TGGCCAAAGTCTTACGTGACAACTCTTCCCTGCTGAAGTT
GGGATATCACTTTGAGTTAGCCGGGCCGAGGATGGCCATG
ACAAACATCTTGAGCCGAAACATGGACAGGAAACGGCAGC
AGCGATTAGAAGCGCAAAAACTCGCCGGACATGAGATCAA
CTCCACTGCACGTGAAGAAAATAAGAGCTCAACTAATAAA
GCTAACTCAAAAACATTGTCCACTCCAAAGAAAGACTCTA
AATTTGCTTCCCTATCAAAATTCACCTCTGCTCAAGAAAA
TTCCAAAGCTTCGCCGACAAAGCCACTGTCTAAACTCCTC
ACCACTGAGGTAACAGGAAGCAAAAAAGGTGCAACAGGAT
GTGGGCAAGCCCCTCCTCCTCCTCCCCCTCCTCCAGGTCC
AGCATTAGATGTTCAGGCACTAAGGAGGTCTTTGACCCCA
GTCTCTCAGAGGAAACCAGATGGCAGTACAGCTGTCCGAC
AGACAGACAGGAGCTCCAGAGATCAGCTCCTGGACTCTAT
CAGAAACTGCAGCATGAATGCTCTCAAGAAGGTTGAGATT
CCCAAGCGGTTGAGATAACATCTGTCCAGTGCACGTGTGT
CTGATTCAGATTCACCTGCAGTCTTCCAGAGCTCTGTTAT
GATGGAGGAGTCACTGAATCGTCAAGATGAGATCCCTTCT
CTACATGCTCAGACATTCAGACACTTTAGACACATGATAT
GTAAACATCTGAGGTGTGAGGCTTTACCATATTAGTGTGA
TTATCCCTGGACTGATAGGAAATGTCAAAGGCCAAATCAA
AAAAAAAACTTTTTTTGGAATGGGTAATTGAAATATAATA
GCCATTTCATTTTAGAATTCTGGCATACTTTAAGATACTT
TTATCTTCTACGATGTGTCTTGTAGCATCTCCACTCATCA
ATTTGCAAATATCATGCCATAACATTTTCAGCTGAAGGTT
CATGATCTCATGCTTTCTGCAGCACATCTTTAATCAGTTA
AATGTTGCATTAAACAGAAATGTCAGTCAGTGTATTTAAA
TGCATTAATGAATTATAGTGTATGCAGAGAATAAAGCAAA
AAATCTCACATTTTTGAGCAACATTTATTATGTATCCTGC
AAATCAAGTTTATGTGTGATACATTAAAAATGTCACTTTA
GAACTATGTTGATTGTAAAAATGGAAATTGCCTTAGACTT
GATCCATCTTTAATGTTACAGTAGTTCAATAAACCTCAAC
AAACAACCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmod1a-201 Contained in:
[BAC] DKEY-193L3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035841 (1),  Ensembl_Trans:ENSDART00000078545 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT699564 (1) 758 nt
GenBank:AL925992 (1) 539 nt
CITATIONS (2)