Transcript

gstt1a-202

ID
ZDB-TSCRIPT-090929-16380
Name
gstt1a-202
Previous Names
  • gstt1a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035796 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035796|OTTDARG00000026825|ZDB-GENE-031001-13 gstt1a|OTTDARP00000028718 gstt1-002 LG_ BX640478.14 Danio rerio protein_coding KNOWN, 1497 bp
TTACTTCCACAATGCCGCTGGAGCTGTATCTCGATCTGCA
TTCCCAGCCATGCCGCTCTGTCTTTATATTTGCCAAGATA
AACAAAATCCCCTTTGAGTACAAAGCCGTGGATTTATCTG
CAGGTGAACAATATGGAGACGAATTCGGCAAAGTCAGCAT
CATAAGGAAAGTTCCTGCTCTCAAAGATGGAGATTTCCTT
CTCACAGAGAGTATAGCTATCCTGCTGTACCTGGCAGGAA
AACACAGCACTCCTGACCACTGGTATCCAGCTGACCTGCA
GAAACGAGCACAAGTGGATGAGTTTCTCTCCTGGCAGCAC
ACGAACATTAGATCTCATGGCTCAAAGGTCTTCTGGTTCA
AGGGAGTCTTGCCTGCGGTCACAGGCGCTCCAGTGCCCAA
AGAAAAGATGGATTCTGCCTTGGAGGATCTCAACATGTCT
TTGAAGATCTTTGAGGACAAATTTCTGCAGAGCAGGCCCT
TCATAATAGGGGATAAAATATCTCTGGCTGATATTGTAGC
CATTGTGGAGATGATGCAGGTACATTAACGTAATTTGATT
TTCTTACACTCTCAGTGACAGCTCCCGCATACCTTTATTT
CTAAGAGTGTATGTGCTGGCTCTGTATATGACATACTGAT
CAGATGTTTTTCTGTGTTTTGAAGCCGGTTGCTACAGGTG
TAGATGTGTTTGAAGGCAGGCCTGCTCTAAGCGCCTGGAG
AGACCGTGTGAAGAAGGAGGTCGGCGTGGAACTCTTCGAT
GAAGCTCATAAAGTTATCATGAATGTTGAATCGTTGCCAC
AAACCTTTGAAAACAAAGGTTTACCAGAGTTTTTTAAATT
AAAGATACAGAAAATGTTTAACTGAGTCTGTTTGAACAGT
TGAACGGTCAAGATTTATGTTTAAACTTTCATCTTTCATT
ATGTTACTGTGTAGTAGTATGGTGTACTGGATCTAAATCT
TTACTCAAAAATAAAATTATTTCTGGTTTATGCAATTGGC
AGTGATTTCTTGCAGCTATCTGTTTTGTGTGTTCCCTAGA
GTCAATCCCATGATCAATCCCATGACCTGTTTAGGGAAAG
ATAGCTCACACTACGGCCATATTTTTAACGCCTCCAGGGC
AGTTATGTCAAGCATGCAACTGTTTAGTTATACAGAGAAA
TGCCAAAATCTCAAGAACAGCTGATCAAATTCATATAAAT
CACATGTTTTAAATGAATAGAAAGGATATTTAGTAAATGT
CAGCTCCTATCCTCCAAAAGTGGTAGAGAATTTAGATTTT
AGGCTAGTGAACGGCACGGCACTTGTATAGAGTATATGTA
ATACTTTTGTAAGAGAAAAAATACTTTTGTAAGTAAAAAG
TTTTGAAGGTGAAATGTCTAAATGCAGGAGTCAAAAATGA
CAGTCACTGTAACAAAAGTTTATATACAAAAACATTGTCA
GGCAAAGAACAAAAATCATTTATCATTTAAATCATTTAAA
ATAATTTTTAAACCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations