Transcript

gstt1a-201

ID
ZDB-TSCRIPT-090929-16379
Name
gstt1a-201
Previous Names
  • gstt1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035795 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035795|OTTDARG00000026825|ZDB-GENE-031001-13 gstt1a|OTTDARP00000028717 gstt1-001 LG_ BX640478.14 Danio rerio protein_coding KNOWN, 1047 bp
GCCTTTATCATGACATCAGTTCCACGTAATTAGATAAACG
AAGCGGACAGCCACAACATGGTAACCTAGTTTTAGGTGTC
GCAAAAACATTGTACTGCCGACCCCTGCAGGGCGGAGCAT
AAACACAGAACATATGAGGGTGAAGGAGTTTGGCGCCTCT
CTTCTTTTCTTGGACACTTACTTCCACAATGCCGCTGGAG
CTGTATCTCGATCTGCATTCCCAGCCATGCCGCTCTGTCT
TTATATTTGCCAAGATAAACAAAATCCCCTTTGAGTACAA
AGCCGTGGATTTATCTGCAGGTGAACAATATGGAGACGAA
TTCGGCAAAGTCAGCATCATAAGGAAAGTTCCTGCTCTCA
AAGATGGAGATTTCCTTCTCACAGAGAGTATAGCTATCCT
GCTGTACCTGGCAGGAAAACACAGCACTCCTGACCACTGG
TATCCAGCTGACCTGCAGAAACGAGCACAAGTGGATGAGT
TTCTCTCCTGGCAGCACACGAACATTAGATCTCATGGCTC
AAAGGTCTTCTGGTTCAAGGGAGTCTTGCCTGCGGTCACA
GGCGCTCCAGTGCCCAAAGAAAAGATGGATTCTGCCTTGG
AGGATCTCAACATGTCTTTGAAGATCTTTGAGGACAAATT
TCTGCAGAGCAGGCCCTTCATAATAGGGGATAAAATATCT
CTGGCTGATATTGTAGCCATTGTGGAGATGATGCAGCCGG
TTGCTACAGGTGTAGATGTGTTTGAAGGCAGGCCTGCTCT
AAGCGCCTGGAGAGACCGTGTGAAGAAGGAGGTCGGCGTG
GAACTCTTCGATGAAGCTCATAAAGTTATCATGAATGTTG
AATCGTTGCCACAAACCTTTGAAAACAAAGGTTTACCAGA
GTTTTTTAAATTAAAGATACAGAAAATGTTTAACTGAGTC
TGTTTGAACAGTTGAACGGTCAAGATTTATGTTTAAACTT
TCATCTTTCATTATGTTACTGTGTAGTAGTATGGTGTACT
GGATCTAAATCTTTACTCAAAAATAAAATTATTTCTGGTT
TATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations