ZFIN ID: ZDB-TSCRIPT-090929-16124
Transcript Name: slc5a9-202
Previous Name: slc5a9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035507 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035507|OTTDARG00000026669|ZDB-GENE-080513-3 slc5a9|OTTDARP00000028537 slc5a-002 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 522 bp
CGAGGAGGTGCCAGCCAAGTTTACTTTGGAGGCTGCTGAT
ATCGCAGTGGTTGTGGTTTACTTTGTGTTTGTATTGGCAG
TTGGAATATGGTCTTCCATCAGAGCCAACCGTGGAACAGT
GGGTGGATATTTCTTGGCAGGACGATCCATGACCTGGTGG
CCAATTGGAGCCTCTCTGATGTCCAGTAACGTCGGCAGTG
GCTTGTTCATCGGATTAGCTGGGACAGGAGCCGCTGGGGG
ACTCGCCGTCGGGGGATTTGAGTGGAATCGTGGGTCCTCA
TCGCCCTGGGCTGGATTTTTGTGCCCGTATATATTTCTGC
TGGAGTGGTCACCATGCCGGAGTATCTGAGGAAGAGGTTT
GGGGGTCAGCGAATCCGGATCTACATGAGTGTGCTGTCTC
TCATCCTCTACATTTTAACCAAGATATCAGTAAGATCTTT
GGGTGGACTGACAGCAGTGATCTACACTGACGCCTTGCAG
ACCGTCATCATGGTAATAGGAGCATTTGTCCTCATGTTCA
TA

slc5a9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript slc5a9-202 522
mRNA slc5a9-201 (1)    Ensembl 2188
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc5a9-202 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035507 (1),  Ensembl_Trans:ENSDART00000141185 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DN833324 (1) 770 bp
CITATIONS (2)