header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16123
Transcript Name: slc5a9-201
Previous Name: slc5a9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035506 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035506|OTTDARG00000026669|ZDB-GENE-080513-3 slc5a9|OTTDARP00000028536 slc5a-001 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 2188 bp
ATGCCAGCTTCACCTGAGCCTGTGACGGCCACTCCAGAGC
CCGAGGAGGTGCCAGCCAAGTTTACTTTGGAGGCTGCTGA
TATCGCAGTGGTTGTGGTTTACTTTGTGTTTGTATTGGCA
GTTGGAATATGGTCTTCCATCAGAGCCAACCGTGGAACAG
TGGGTGGATATTTCTTGGCAGGACGATCCATGACCTGGTG
GCCAATTGGAGCCTCTCTGATGTCCAGTAACGTCGGCAGT
GGCTTGTTCATCGGATTAGCTGGGACAGGAGCCGCTGGGG
GACTCGCCGTCGGGGGATTTGAGTGGAATGCAGCGTGGGT
CCTCATCGCCCTGGGCTGGATTTTTGTGCCCGTATATATT
TCTGCTGGAGTGGTCACCATGCCGGAGTATCTGAGGAAGA
GGTTTGGGGGTCAGCGAATCCGGATCTACATGAGTGTGCT
GTCTCTCATCCTCTACATTTTAACCAAGATATCAACAGAC
ATTTTTTCAGGGGCTTTATTCATTCAGGTGTCACTGGGGT
GGGATCTTTATCTCTCCACTGTTATTCTGCTGGCCGTCAC
TGCACTCTATACTATAGCTGGTGGACTGACAGCAGTGATC
TACACTGACGCCTTGCAGACCGTCATCATGGTAATAGGAG
CATTTGTCCTCATGTTCATAGCATTTGACAAGGTTGGATG
GTACGAGGGTTTGCTGGTTCAGTATGAGAAAGCTGCACCT
GCTCTCACAGTTCCCAACACCACTTGTCATCTTCCTCGCT
CTGATGCCTTTCATATCTTCAGAGACCCAGTGACGGGAGA
TATTCCCTGGCCCGGCCTGATCTTCGGCCTTACCGTTCTG
GCCACATGGGTCTGGTGCACAGACCAGGTGATAGTGCAAA
GGTCTCTGTCGGCAAAAAACCTGTCTCATGCCAAAGCTGG
TTCAGTGCTCGGTGGCTACCTCAAGGTCTTCCCTATGTTC
TTCGTAGTCATGCCAGGAATGATCAGCAGAGCTCTCTATC
CTGATGAAGTAGCATGTGTTGATCCCGATGAGTGTCAGAA
GATCTGTGGGGCCAAGGTCGGCTGCTCGAACATTGCCTAC
CCAAAATTAGTGGTGGAGCTCATGCCAGTGGGTATGAGAG
GGCTGATGATCGCTGTAATGATGGCAGCACTCATGTCCTC
TCTCACCTCTATATTCAACAGCAGCAGCACCTTATTCACT
ATGGACATCTGGCAGCGGATCCGGCCCCGGGCCTCTGAGA
AAGAGCTCATGGTAGTGGGCAGAGTGTTTATTTTATTGCT
AGTGGCCTTGAGCATTGTGTGGATTCCAGTCATTCAAACG
GCTAATAGTGGACAGCTGTTTGACTACATTCAGGCTATAA
CTAGCTTCCTGTCACCTCCCATCACCACAGTGTTCATTAT
GGCCATATTTTGGGGGAGAGTAAATGAACAGGGAGCTTTT
TGGGGTCTGATGGTGGGACTAGTGGTGGGCATGGTGAGGA
TGATAATGGAATTTGTCTATGGCACACCATCATGTGGAGA
GACAGACCTGCGTCCCAGCCTGCTGAAGGATGTGCACTAC
CTGTATTTTGCGCTTATTCTGCTCGCCCTGACAGTTCTGA
TCATCACAGCCGTCAGCCTCTGCACTGCACCTATTCCAGA
AAAACACCTTGTTCGTTTGACCTGGTGGACAAGACACAGT
AAGGAGGAGCGTGTAGAGCTGGAAGACCCCTGGGCCAAAC
CAGCAGGCTCTGATCTCAGCACAACGGAGTCAGAGGGGTC
GGATGAGGACGCGCCTGCATGGTGGAAACGTGCTGGAATG
TGGCTGTGTGGACTCTCCCAAACGACTAAACAAGACCTGA
CTGAGGAGGAACGGCAGGCACTGGAAAAGAAACTCACTAG
TATTGAAGAAGACCACATGTGGAAGACTGTGTGCAACGTC
AATGCCCTCATTTTGCTCACTGCCAATGTGTTTCTTTGGG
GGTACTTTGCTTGAATGTACTGTAAAGTTCTATAATGGCT
AATTGTTTTGTTAGAAACTAATAGTTTAAGTGTTGACGTT
GGCACTTTGAACACTCATTTTTATTTAAAATGTTTTGAAT
AACATTTTATTTGAAGTTTGTTGCAAACAATATTAAATAA
TTACTGCTGTGCCATAATGACAAAGCCATGAATGAATGCA
TAAATAAATAAATAATAAATATATAAAA

slc5a9 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript slc5a9-202 (1)    Ensembl 522
mRNA slc5a9-201 2188
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc5a9-201 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035506 (1),  Ensembl_Trans:ENSDART00000024433 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC115268 (1) 2137 bp
CITATIONS (2)