header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16122
Transcript Name: zgc:171480-201
Previous Name: zgc:171480-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035505|OTTDARG00000026668|ZDB-GENE-080204-83 zgc:171480|OTTDARP00000028535 DKEY-7O6.4-001 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 863 bp
CGGAACTAACAGAAGCTGCCGTACAAGTTTCCAGGGGGAC
ATTTATGCTGATGCACCTCCATGCCGTTTGTTGATGGTGA
CCTTCTTCATCCTGAAGTTATGTATATAATCTTACACTTA
TGAATACATTTATTAGATAGACAACTCCAACGTTGCAAAC
ATAATGACAATGGCTTTAAATACAGTTGGTCATCCCTGCA
AGGGCTTATTTAGGTGTCTTCAGGCAGTTTTCACCCACAG
ATGTTTGCAAGCCACATCCTCATTTCACAGCACAGTCATT
CAGTCAGATTCCAACAGAACCAGCGTGGTCCGGCTTGGCA
GGCAGAAATATGAGAGAATGTATCCAGTTCTGCTGGTCAG
ACCTGACGGGTCCACCATCAACATCAGATATCAGGAGCCC
AGAAAGTTAATGAAGATGCCTGTGGACCTCACCACACTCT
CTGAAATGGAGAGGAAAATCAGGATGCGGAAAAGAGAACC
GAAGAAGGCAGTGAAGAAAGAATTGGAAGATTTTGATGAT
GATTTCAAAGCTGACGATTACAGCAAATTCTGGAAGAAGA
AATGAGTGGACTGATGTGATTGATGCCTCCTTTATAATAT
TTATGTTGTCTTGACAAATACACTTTTGTTTTATGTCACC
CTCCAATTAAAAATTCAAATATTTGTAGTGAGCATTGTAT
CATTATGAATTGGGACTATTTTTTGAAATTATATGCTTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGAGAGAATATCAAA
TATAGCTGATATAATGTTACGTGGTCATTCAGGTTAACAG
ATATGTTTATGGACAAAATTAACACTTAATTTGATCTTTA
TTGAATAAAAAAAAAGAAAAGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:171480-201 Contained in:
[BAC] DKEY-7O6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035505 (1),  Ensembl_Trans:ENSDART00000063717 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC135042 (1) 1625 bp
GenBank:BC122202 (1) 844 bp
GenBank:EH503715 (1) 696 bp
CITATIONS (2)