ZFIN ID: ZDB-TSCRIPT-090929-161
Transcript Name: orc6-201
Previous Names: orc6-001, orc6l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002295 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002295|OTTDARG00000002129|ZDB-GENE-030131-2976 orc6|OTTDARP00000002027 RP71-34G2.2-001 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 1692 bp
AAACAATACTGAGAATTATTATTTATGTATCCATAATAGT
AAAATTAGCTGCGTTGTGTCATTATAGAATAATAACTGAG
GTAAATTGTATTTAGAAAATAATAGTTTCTCTGAACAACA
TTCGGTTAGCATCTAATGACAATAAAATAATTTAACGTCG
CTTCGACAGATAAAAAATTTATTTACAAGGAATTTATGTT
GATCATGAACGACGTTATCCACGCCCATTTGTGAAGCAAC
CAATGACAGGCCAGAACGTTTATTCCTGGTGCGACACGTG
TTCATTTTCGCGCGAAATTGTTCAGTGTTCTGTGGAGCGT
CCTCTGTTGTGTTCTGCTGTGTTGTTGCAGTAAAGGGTTT
ATAAAATGGATAAAGAGTTGTTTCGTAAGCTTGCTTCGAA
GATTGGGATAACATCGATTAAAGTGTTAAGTCAAGCAGAG
GAGTACATGCGATTATCCCAAGTGAAATGTGTCGGCTTGG
GTTCTGGGACTGCAACCAGCAAAGCTGTTATTTGTCTTGA
ATTGGCAGCGACTGCAATGAAGTTTCCTCTGGACAAGGAG
TATGCCATCAAACTGTCTGGACTGAATCCTAAGGTCTACT
CCAGCAATTTGAAGACTATGGAGTGCATGCTGGGCCTGCA
GTCAAACCTGGGTCTCCGAGATCTAGCAGTCCAGTTTGGG
TGTTTAGAAGCAGTTAAAGTGGCTTCTCAAATCCTTCAGC
GGTATGAGACCAGTTTGCCTGCAGCTCAGCAGCAAGATCT
TGACTTGACGAAGCCTCTCTTTACCACAGCGGCTCTGTAT
ACAGCATGCAAGTGCATGAAAATCAGAACTGACAGGAAAT
TAGCCTCTTCATCTGGAGCCAAGAAGAGCATCTTTGACCG
GCTCTGTGCACAGTTTCAGAAATTTGGACAGGAGATCTGC
AATGAGGCTTCGTCTTTGGAGAAACCAGTCAAAGGCACTC
AAAAGAGGCAGAAGACACTCACTGAAATGCTGGAAATGGA
AGATGATGATAAACCTCTGACGTCTCCCAAGCAAGAGCGG
GTTGAGAAGACTGAGGAGGAGGAGACTCACCACTATGAGG
AGTGGAAGAGAAAAATCCTGGAAAATGCATTAAAAGCAAA
AGCTGTAGATTCCTGAAGTATGTACAGTTTTATATTTTCT
TTTTATTTAATTGTGGACTTTCATAATATCTGGAAGATCT
CACTTGGAGCTGAATTCTGTATTCTACCAAGAGAAGTTGT
ATGCCCCCTTCTGGCTGCTTGAGTGAAATTTTTACCCACA
TACAGACATTACTAGAATAATTATGGCACTTTTTATTGTA
GTTTTGTTTTAATGCCATTTTACCATTGCAAAAGAGTTTC
TGATTGATTTTTTTATAATGTGGTAAGATGTTTAATCCTC
ATTTATATAATGTATTACAAATGGCAGCATTTTATCATAG
CTCATTTAGCATGTCAGAATGAAACTGTTGAATCCATTAC
GGATTGGATGATTTACCTGGTTTTAATCTAAGCTCATTTC
TCAGTGTTCTGTTGTATTGCTTTGGGTCGCTGTAATTCGT
TATACTCGTCAAAGGAGGAGTATAACGACTCAAGGTCAAC
TGGAAGGGTTTTATTCGTTTGTTTTAATAAGACATGACTC
ATTTGCTTCCATTTGGATTTTAATGTGAATAAAATGGGTG
TTCTTGACACAA

orc6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA orc6-201 1692
orc6-202 (1)    Ensembl 2054
orc6-203 (1)    Ensembl 885
orc6-204 (1)    Ensembl 904
ncRNA orc6-002 (1)    Ensembl 731
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
orc6-201 Contained in:
[BAC] RP71-34G2 (1)

Genome Resources: Vega_Trans:OTTDART00000002295 (1),  Ensembl_Trans:ENSDART00000113732 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW134040 (1) 823 nt
GenBank:AL716083 (1) 742 nt
GenBank:AL717947 (1) 717 nt
GenBank:AL716047 (1) 672 nt
GenBank:BM156613 (1) 625 nt
GenBank:BI980508 (1) 604 nt
GenBank:BI709681 (1) 570 nt
GenBank:AI658152 (1) 550 nt
GenBank:AL726452 (1) 547 nt
GenBank:BI708277 (1) 528 nt
GenBank:BI983529 (1) 497 nt
GenBank:BM184705 (1) 474 nt
GenBank:AI332229 (1) 442 nt
GenBank:BI979234 (1) 425 nt
CITATIONS (2)