ZFIN ID: ZDB-TSCRIPT-090929-1593
Transcript Name: cacna1c-202
Previous Name: cacna1c-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009736 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009736|OTTDARG00000008481|ZDB-GENE-020129-1 cacna1c|OTTDARP00000008380 cacna1c-001 LG_none BX649380.7,BX248410.4 Danio rerio protein_coding NOVEL, 6852 bp
ATGGTAAATGAAAGCAAAAACATGTACATACCGGAGGACA
CCCTTGAAAACCATCAAGGCTCCAACTATTCCAGTCCGTC
GTTGGCTCCGGTCCCCAGTCTGAATGAGGACGAGCATGTG
GGGGGCGGGGGTGGGGTGCTGGGTCTTGCACCTGAACACA
TTCCCACCCCTGGCGCCCCCCTTAGTTGGCAGGCAGCCAT
TGACGCGGCACGGCAGGCCAAGCTGATGGGCACCACCGGA
GCACCAATCTCCACTGCGAGCTCCACGCAGCGCAAACGCC
AGCATTACACCAAACCCAAGAAACAGGCCAGCACTGCCTC
CACACGCCCACCCCGAGCCCTTCTCTGCCTCACTCTCAAA
AACCCCATCCGCAGGGCGTGCATCAATATCGTGGAATGGA
AACCGTTTGAAATCATAATTTTGATGACTATTTTTGCAAA
CTGTGTGGCCTTAGCTGTCTACATCCCTTTCCCTGAGGAC
GATTCCAACGCAACCAACTCAAATCTGGAACGGGTGGAGT
ATCTCTTTCTGATCATTTTTACGGTGGAAGCCTTTCTGAA
AGTTATTGCTTATGGGCTGCTGTGTCACCCTAATGCATAC
CTGCGGAATGGCTGGAACTTGTTGGATTTCATCATCGTGG
TCGTAGGGCTCTTCAGTGCAATATTAGAGCAGGCCACTAA
AGGGGATGGTGGTACTTCAATGGGAGGCAAAGCTGCAGGG
TTTGATGTAAAAGCCCTTCGAGCCTTCAGAGTGTTGAGAC
CTCTAAGACTCGTGTCTGGAGTACCTAGTTTACAGGTGGT
GCTGAACTCCATCATTAAAGCCATGGTTCCCCTCCTTCAC
ATCGCTCTGCTCGTTCTGTTCGTCATCATCATTTATGCCA
TCATCGGCCTCGAGCTCTTCATGGGCAAGATGCATAGAAC
CTGTTTCTTCTATAAAGATGGACACAAAGGTCATATAGCT
GAAGAGAAGCCGGCCCCCTGCGCTCCAAGCTCCGCCCATG
GAAGACACTGCTCTCCGCCCAACATAACGCAGTGCATGAT
GGGATGGGAGGGCCCAAATGATGGAATCACGAACTTTGAT
AACTTTGCATTTGCCATGCTGACTGTGTTTCAGTGCATCA
CGATGGAGGGCTGGACTGATGTCCTGTACTGGATGCAGGA
TGCCATGGGTTATGAGCTTCCATGGGTCTATTTTGTCAGT
CTGGTCATCTTTGGATCCTTTTTCGTTCTTAATCTGGTTC
TGGGTGTGTTGAGCGGAGAGTTCTCTAAAGAGCGAGAAAA
GGCCAAAGCTCGTGGTGATTTTCAGAAGCTCCGTGAGAAG
CAGCAGCTGGAGGAGGATCTAAAGGGCTACCTGGACTGGA
TCACGCAAGCAGAGGATATTGACCCTGAGAATGACGACGA
GGGACTGGATGACGACAAGCCTAGAAATCTGAGTATGCCG
GCCAGTGAAAATGAGTCAGTGAACACTGATAATGCTCCAG
CTGGAGACATGGAAGGAGAGACCTGCTGTACCCGTATGGC
AAATAGGATCTCCAAATCCAAATTCAGTCGATATTCACGC
CGGTGGAATCGGTTATGTCGGCGTAAGTGCCGTGCAGCAG
TGAAATCAAACGTCTTCTACTGGCTGGTGATTTTTCTGGT
ATTTTTGAACACACTTACTATTGCCTCAGAGCATCACCAG
CAGCCGGAGTGGCTCACCAATGTACAAGATATAGCCAATA
AGGTGCTGCTGGCTCTCTTTACGGGTGAGATGCTGTTAAA
GATGTACAGTCTGGGCCTACAGGCCTATTTTGTCTCCCTT
TTCAACCGATTTGACAGCTTTGTGGTGTGCGGTGGGATTC
TGGAAACCATCCTGGTGGAGACCAAAATAATGTCACCCCT
GGGCATCTCTGTGTTGCGCTGCGTACGTCTGCTTCGCATC
TTCAAGATCACCAGATACTGGAACTCTCTGAGTAATCTAG
TGGCGTCTCTGTTGAACTCTGTGCGTTCGATCGCATCCCT
GTTACTGCTGCTCTTCCTCTTCATTATCATCTTCAGTCTG
CTCGGAATGCAGCTCTTTGGTGGAAAGTTCAACTTTGATG
AGACTCGACGCAGCACATTTGATAATTTCCCTCAGTCTCT
CCTCACCGTCTTTCAGATTTTGACCGGAGAGGACTGGAAC
TCTGTAATGTACGATGGCATCATGGCGTATGGAGGGCCGT
CCTTTCCTGGCATGCTTGTCTGCATTTACTTCATCATCCT
CTTCATCTGTGGAAACTACATCCTCCTGAATGTCTTCTTG
GCCATTGCTGTGGACAACCTCGCAGACGCAGAGAGTCTAA
CATCAGCGCAGAAAGAGGAAGAGGAGGAGAAAGAGAGAAA
GAAGCTGGCCAGAACGGCCAGTCCAGAGAAGCGCCAGAAC
TCTGAGAAACCACCCCTAGAGGATGAAAAGAAAGAGGAAA
AAATTGAACTCAAATCCATCACTTCAGATGGAGAGACGCC
AACTGCCACCAAGATCAACATAGATGAGTACACAGGGGAG
GACAACGAAGAGAAAAATCCATATCCTGTCAACGATTTCC
CAGCAGGGGAGGATGACGAGGAGGAGCCAGAGATGCCAGT
AGGTCCTCGTCCACGTCCACTCTCTGACATTCAGCTGAAG
GAGAAAGCCGTCCCCATGCCACAAGCCAAAGCCTTCTTTA
TTTTCAGCCCCAGTAACAAGTTCAGGGTTTTGTGTCATAA
GATTGTAAACCACAACATCTTCACCAATTTAATCCTGTTC
TTCATACTGCTGAGCAGTATTTCACTGGCAGCGGAGGACC
CAGTGAAGAATGACTCATTCAGGAATCAGATTCTAGGCTA
TGCAGATTATGTGTTTACAGGAATCTTCACCATAGAGATC
ATATTAAAGATGACAGCGTATGGAGCATTTCTTCATAAGG
GTTCATTTTGTCGGAATTATTTTAATATTTTGGATCTGGT
GGTGGTCAGTGTGTCTCTGATCTCCTCTGGAATTCAGTCA
AGTGCCATTAATGTAGTGAAGATTCTCAGAGTGCTGAGGG
TGTTGAGGCCCCTGAGAGCAATCAACAGAGCCAAGGGCCT
CAAACATGTGGTTCAGTGTGTGTTTGTTGCCATCCGCACC
ATCGGGAATATCGTCATCGTCACCTCTTTGCTGCAGTTCA
TGTTTGCCTGTATTGGTGTTCAACTCTTTAAGGGCAAATT
CTTCTACTGCACAGACACTTCTAAACAGACGCAGGCTGAG
TGCAGAGGGGCCTATATACTGTACAAGGATGGGAATGTTG
GAAAGCCAGAGAAAGCTCAACGCTCCTGGGAGAACAGTGA
CTTCAACTTTGATGATGTCCTACAGGGCATGATGGCTCTG
TTTGCTGTGTCCACTTTTGAGGGTTGGCCAGGGCTCCTCT
ACAGAGCCATCGACTCCCATGCAGAGGATGTTGGGCCGAT
CTACAACTACCGTGTGGTCATCTCCATATTCTTCATCATC
TACATTATCATCATCGCATTCTTCATGATGAACATATTCG
TAGGTTTCGTCATTGTGACGTTTCAGGAGCAGGGAGAGCA
AGAGTACAAAAACTGTGAGCTGGACAAGAACCAGCGTCAG
TGTGTGGAGTATGCCCTGAAAGCTCGTCCCCTACGCAGGT
ACATTCCCAAAAACCCATATCAGTACAAAGTCTGGTACGT
GGTGAACTCTACCTACTTTGAGTACCTGATGTTCACGCTC
ATCCTTCTCAACACCATCTGCCTGGCCATGCAGCACCATG
GTCAATCTCAGTCTTTCAACAAAGCCATGAATATCCTCAA
TATGTTGTTCACTGGCCTCTTCACTGTGGAAATGATCCTC
AAACTCATCGCTTTCAAACCCAGGGGTTACTTTAGTGACC
CCTGGAATGTTTTTGACTTCCTCATCGTAATTGGCAGCAT
TATAGACGTCATTCTGAGTGAGATCAACCATTATTTTGTT
GATGCATGGAACACGTTTGATGCCCTTATTGTAGTGGGTA
GTGTTGTTGATATAGCCATCACAGAGGTTAACCCAGCTGA
CCCCTCCTCCTCTCCCCCCTCCTCTGTGGTAAGACCAATG
GGCCTCCAAAACACTGAGGATAACGCCAGGATCTCAATCA
CATTCTTTCGGCTGTTCCGCGTGATGAGGCTGGTGAAGCT
CCTGTCTCGGGGAGAGGGTATTCGGACGTTGCTCTGGACC
TTCATTAAATCCTTTCAGGCTCTTCCCTATGTTGCATTGC
TGATCGTAATGCTGTTCTTCATTTATGCCGTCATTGGGAT
GCAGATGTTTGGCAAAATCGCCCTGAGGGACAACAGTCAG
ATCAACCGAAACAACAACTTTCAGACATTTCCTCAGGCTG
TTCTGCTTCTCTTCAGGTGTGCGACAGGAGAGGCGTGGCA
GGAAATCATGCTGGCCTGTTCTCCAAACCGCCCTTGTGAG
AAGGGGTCAGAGATCAACCATTCCAGCGAAGACTGTGGCA
GTCACTTTGCCATCTTCTACTTTGTTAGCTTTTATATGCT
TTGCGCCTTCCTGATCATTAACCTTTTTGTGGCTGTCATC
ATGGACAACTTTGACTATTTAACACGGGATTGGTCGATAC
TGGGACCGCATCATCTAGATGAGTTCAAAAGAATATGGGC
AGAATATGATCCTGAGGCTAAGGGTCGGATAAAGCATCTG
GATGTAGTCACGTTACTGCGCAGAATTCAGCCACCTCTTG
GATTTGGAAAGCTTTGTCCACATAGAGTGGCATGCAAGCG
ACTTGTGTCCATGAACATGCCTCTCAATAGTGATGGAACG
GTGATGTTTAATGCAACTCTTTTTGCCCTGGTACGAACGG
CTCTACGCATCAAAACCGAAGGTAACCTGGAGCAGGCGAA
TGAGGAACTTAGGGCCATCGTGAAGAAGATTTGGAAGAGG
ACAAGCATGAAGCTGCTGGATCAAGTTGTTCCCCCTGCTG
GAGATGATGAAGTCACAGTGGGGAAGTTCTATGCTACATT
CCTAATTCAGGAATACTTCAGGAAATTCAAGAAGCGCAAG
GAACAGGGCCTGGTGGCCAAAATACCCCCAAAGACTGCTC
TTTCACTGCAGGCTGGCCTGCGAACACTACATGATATGGG
TCCAGAGATCAGAAGAGCGATATCAGGAGACTTGACCGTG
GAGGAGGAGCTGGAAAGGGCCATGAAGGAAACTGTGTGTG
CTGCTTCTGAGGATGATATCTTCAGGCGGTCTGGTGGCCT
CTTCGGTAACCATGTAAACTACTACCATCAGAGTGATGGC
CACGTCTCCTTCCCACAGTCCTTCACCACACAGCGGCCAT
TGCACATCAGTAAATCCGGGAGTCCCGGCGAGGCTGAATC
TCCCTCTCATCAGAAGCTGGTGGACTCCACCTTCACTCCC
AGCAGTTACTCTTCCTCAGGATCCAACGCCAACATCAACA
ACGCCAACAACACCGCCATCGGACACCGCTATCCCAAACC
TACTGTCAGCACGGTGGACGGACAAACAGGGCCTCCTCTC
ACCACCATCCCACTGCCACGACCCACATGGTGCTTTCCTA
ACAAGAGCTCTGATTCCAGTGACAGTCGTCTCCCTATAAT
ACGGCGAGAGGAAGCATCTACAGATGAGACATATGATGAA
ACATTTTTAGATGAGAGAGATCAGGCCATGCTCTCCATGG
ACATGCTGGAATTTCAGGATGAAGAAAGCAAGCAACTGGC
TCCTATGGTGGAGGCAGAAGTAGGGGAGGAGAGAAGGCCG
TGGCAGTCTCCACGGCGACGGGCCTTCCTCTGCCCTACTG
CACTGGGTCGACGGTCTTCCTTTCACTTGGAGTGTCTGAG
AAAGCATAACAGACCTGACGTTTCTCAGAAGACAGCACTA
CCATTGCACCTAGTGCATCATCAGGCTCTGGCCGTGGCAG
GGTTAAGTCCCTTGCTGAGACGGAGTCACTCTCCGACACT
GTTCACACGTCTGTGTTCCACACCTCCTGCGAGTCCCAGT
GGCCGCAGCGGTGGAGGCCCATGCTATCAGCCTGTGCCCT
CTCTGCGGCTGGAGGGCAGCGGATCTTACGAGAAGCTCAA
CAGCAGCATGCCGTCTGTGAACTGCAGCTCGTGGTACAGC
GACAGCAACGGCAACCACAGCGGGAGGGCGCAGCGACCCG
TGTCCCTTACAGTTCCTCCGGTCACGCGCAGAGACTCTAT
ATCCCTGGCACACGGGAGCGCCGGCAGCCTCGTGGAGGCG
GTATTGATATCTGAGGGTTTGGGTCGCTATGCACATGATC
CCTCCTTCATCCAGGTAGCGAAGCAGGAAATAGCGGAGGC
CTGTGACATGACAATGGAGGAGATGGAGAACGCGGCAGAC
AACATTCTCAACGCTAACGCACCACCCAACGCTAACGGAA
ACCTGCTTCCCTTCATACAGTGCAGAGACACTGGCTCGCA
GGAGTCCCGTTGCAGCCTCTCACTGGGCCTTTCTCCCGCC
ACAGGCTCTGATGGGGCACTGGAGGCGGAGCTAGAGGAGT
CAGAGGGGGCGGGGCAGCGGAACAGCCCTCTGATGGAGGA
TGAGGACATGGAGTGCGTCACGAGTTTGTAGGGGGAACAG
CAGCAGCACGGAGGACGTCCTGTGTCTTAGCCCAGCTCTC
TCTGAGGACACTGCTGTCCTGCAGTCTGACCTGTCTGTTG
CGTGTACCTATAGGGGTATAAGGCCATTCTGCTTAGCTGA
GACCGAGTTGGTTTTTAGTTTGTCCGTGTGTTTGCGAGAG
CACGAGCGAGTAGGTGTGTGTACATGTTTGTGTGCGTGTT
TCTAAAAGTGCCTCACAGTTCTCACAACCTTGATTGCAGT
AAGAAAACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cacna1c-202 Contained in:
OTHER cacna1c-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009736 (1)
  • Ensembl_Trans:ENSDART00000132909 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF305689 (1) 6776bp
    GenBank:AL919682 (1) 370bp
    CITATIONS (2)