ZFIN ID: ZDB-TSCRIPT-090929-158
Transcript Name: si:rp71-1h20.5-201
Previous Name: si:rp71-1h20.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002292 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002292|OTTDARG00000002127|ZDB-GENE-030131-7869 si:rp71-1h20.5|OTTDARP00000002024 RP71-1H20.5-001 LG_ AL627305.12 Danio rerio protein_coding KNOWN, 1055 bp
TGTGGAGGTGGATGAACTCAAACAGCCTCATCATTTCAAA
AATGAAGATGCAAATGCAGCTGAGCAAGATTTCACACAGA
AACAAGTGCAAACCGCTGAAGCTAAAGAGCTGTTCGCCTG
CTCTGAGTGCGGTAAGAGCTTCATACATAAATCCAAACTT
AAAGTACACATGCGAGCTCACAGTGGAGAACGACCGTTCA
CCTGCTCTGAATGTGGAAAGAGTTACATGATTATATCAGC
GCTCAACAGACACGCTAAAGTTCACATTGGGGAGAGATCT
CATATATGCGCAGAGTGCGGCAGCAGTTTTGTTTTTAAAG
CACATTTAAAGGAGCACATGAAGATTCACAGTGGAGAAAA
ACCCTTCACATGCGCTCAATGCGGAAAAAGAAGAAGAGCG
CGGAAAGAATGTAAACATGAGAAATGAAACAGCCGTTCAT
AATGCTCTGAATATACTGTATTTATCTCACTTCATTAATT
TCGCGTGTTTACCGATTTAAACCGATGATGTGATCAAACA
GGAGGAGAAACAACTGAAATGCCATAGTACAGATGGAGAT
TAAAGAAGAACCCTGCAGAATAAAAGAGGAAGTGACTGAG
AAACTAATAGGCCCTGTGGAGGTGGAGGAACTCAAACAGC
CTCATCATTTCAAAAATGAAGATGCAAATGCAGCTGAGCA
AGATTTCACACAGAAACAAGTGCAAACCGCTGAAGCTAAA
GAGCTGTTCGCCTGCTCTGAGTGCGGTAAGAGTTACACAT
ATAAATCCTCCCTTAAAAAGCACATGAGCGCTCACAGCGG
AGAAAAGCTGTTCGCGTGTACTCAATGCGGAAAGAGCTAC
ATGTATAAATCAGATCTTAACAGACACTTTAAAGTTCACA
ACGGAGACAGACCTTATATATGCAGCGAGTGCGGAAGCAG
TTTCATTTATAAAGGACATTTAAAGGAGCACATGAAGATT
CACAGCGGAGAAAAACCCTTCACGTGCGCTCAATGCGGAA
ACGGTTCTTCCTCAATCTCCATCTTTACTATAGTATGTCA
GTTGTTTCTCCTCCT

si:rp71-1h20.5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:rp71-1h20.5-201 1055
si:rp71-1h20.5-202 (1)    Ensembl 1600
si:rp71-1h20.5-203 (1)    Ensembl 873
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:rp71-1h20.5-201 Contained in:
[BAC] RP71-1H20 (1)

Genome Resources: Vega_Trans:OTTDART00000002292 (1),  Ensembl_Trans:ENSDART00000163781 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BM181289 (1) 579 nt
CITATIONS (2)