ZFIN ID: ZDB-TSCRIPT-090929-11552
Transcript Name: si:rp71-1h20.5-202
Previous Name: si:rp71-1h20.5-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029126 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029126|OTTDARG00000002127|ZDB-GENE-030131-7869 si:rp71-1h20.5|OTTDARP00000023805 RP71-1H20.5-003 LG_ AL627305.12 Danio rerio protein_coding KNOWN, 1600 bp
GTGTCGGGTTCTGCCAGTGGTGGCGCTCGACCACCGGAAA
CAACACCGAGATTTAAGAGAAGAAGAGCGCGGAAAGAATG
TAAACATGAGAAATGAAACAGCCGTTCATAATGCTCTGAA
TATACTGTATTTATCTCACTGAGGAGAAACAACTGAAATG
CCATAGTACAGATGGAGATTAAAGAAGAACCCTGCAGAAT
AAAAGAGGAAGTGACTGAGAAACTAATAGGCCCTGTGGAG
GTGGAGGAACTCAAACAGCCTCATCATTTCAAAAATGAAG
ATGCAAATGCAGCTGAGCAAGATTTCACACAGAAACAAGT
GCAAACCGCTGAAGCTAAAGAGCTGTTCGCCTGCTCTGAG
TGCGGTAAGAGTTACACATATAAATCCTCCCTTAAAAAGC
ACATGAGCGCTCACAGCGGAGAAAAGCTGTTCGCGTGTAC
TCAATGCGGAAAGAGCTACATGTATAAATCAGATCTTAAC
AGACACTTTAAAGTTCACAACGGAGACAGACCTTATATAT
GCAGCGAGTGCGGAAGCAGTTTCATTTATAAAGGACATTT
AAAGGAGCACATGAAGATTCACAGCGGAGAAAAACCCTTC
ACGTGCGCTCAATGCGGAAACAGTTTCATGTACAACAAAG
ACTTAAATGCGCACATGAAGATTCACAGCGGGGAAGACAT
GTTCGAGTGCACTCACTGTGGAAAGAAGTTCACACGTAAA
GGACACTTGAACGTGCACCTGAGAGTTCACACTGAAGATA
AACCGTTCGCATGCGCTGAATGTGGGAAGAGCTTTAAATA
CAAAAGCGTACTCAATAATCACCTGCACACTCATGCTGAA
GTCAAGTCGTTTAGCTGCGATCAGTGCGGGAAATCGTTTG
TTTGTGCGTCAAACTTACGAACACATCTTAAAGTTCACAC
TGGTGTGAAGCCTTACATTTGTGCATTTTGTGGAAAGAAG
TTTCTACATATGAGTTATTTAAAACTGCACCAGCACACTC
ACACTGGAGTGAAACCTCATGCGTGTTCAGTCTGCGGGAA
GAGCTTCGGTTTATTAAGCAACCTAAAAAAGCACCAGAGG
ATTCACACCGGAGAGAAACCGTACATGTGCTCACACTGTG
GGAAGAGTTTCTCCTGTTCGTCAGCTGTGAAAGCTCATGA
GAGGATCCACACCGGAGAGAAGCCGTATCCGTGCTCGTCG
TGTGGGAGGAGGTTTGCTCTTTTTCATAATATGCGAAGTC
ATGAAAAAAAACACCGGCTAAAGTTGTCCTTGTAAGCAAA
AGTTTGTGTGTTTGTTTTGTAAACCTGTATAGTAATCTGA
AATATGACATTATAATCAAATCAGATGCGTTATAATCTCA
TATATTCATGCTGCCAACACTGAGGGTTGATTCTGTAAAA
AATGCTGGGCTCCACACAATCGATTTGTGGTTTTTTTGAG
CTTAGAGCTGCACAATATATTGTTTAAGCATCAAGATTGC
AATGTTTTATTACATTTATTATTATTATACACTCACCGCC
GGCCATTTTATTAGGTATACCTTTTTAGTACAGTGTTGGG
CCCCCTTTTACCTTCAGAACTGCCTTAATCCTTCGTGGCA

si:rp71-1h20.5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:rp71-1h20.5-201 (1)    Ensembl 1055
si:rp71-1h20.5-202 1600
si:rp71-1h20.5-203 (1)    Ensembl 873
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:rp71-1h20.5-202 Contained in:
[BAC] RP71-1H20 (1)

Genome Resources: Vega_Trans:OTTDART00000029126 (1),  Ensembl_Trans:ENSDART00000166003 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC090510 (1) 1640 nt
CITATIONS (2)