Transcript

serpine3-003

ID
ZDB-TSCRIPT-090929-15797
Name
serpine3-003
Previous Names
  • im:7152538-003
  • si:ch211-219a4.10-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035119 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035119|OTTDARG00000026449|ZDB-GENE-050309-223 serpine3|no_translation CH211-219A4.10-003 LG_ CR533429.7 Danio rerio protein_coding NOVEL, 905 bp
AAGCAGATCACGGCCCGTGCTGTGGGACTGTGGGATACTG
GATTAAGACGCACTAAAATGGATATATTTCTGCCCAGTTT
AAGATGCAGAGCAAGATCAATTTGAAGCCTGTTCTACAGT
CTCTTGGCGTCTCTGACATCTTTAGTCCATCAGCTGCTGA
TTTTAGAGGCATCTCGGGTATGAAAGTGGAACTGAAAACA
ATTTACAACAGTCTAAGAATGTCAGAAACAATACCAAATA
TATATCACTGGCTATATACTCTGGTTTATGTGTCTCTACA
GATACAGATGGGATTTTTGTATCAGAGGCTTTCCATGAGG
CAAGAATAGAGGTGACAGAGGCAGGCACAAAAGCAGCTTC
AGCTACAGGTATGTTGTTTCGTTGCTTATTGACCAAATTT
TTTTCACTTTTTAAGAATGGGCGCAGCCATCAGAACTTAA
TTATCTCGATACTTTCAGACTCATTGTTTCAGTGGTTGTT
AACTGTTAAAGAGCCATCTGTTATGCTGCTTGATGTTGTG
AACTGTTTTGATTCTATTATTTAAATTTCTTTATCTAGCC
AAAAACACAATTGTTTGTAGAGCAAGTAACTTGACATTTT
ACTGCAGACTGTTTGTTATTCCTAGTCAAAAAACTGTCAC
AAAAAATAGCTTACTTCCACATTGCAGAATAAAGCGAACC
AATTAGTTAAGTAAAAGATTAGTAAAGAACATCTGAATAT
TATGTCAGTTTGAAGTGCTTCTGTTGCTTTTACCCTAATG
GAGTGTATAATGTTAGTAAATGTATCCTCAAACTACAGTA
GTAATTTTAAATGGTCAGTAATGACATAGTAGTTGTCAGC
CTAATCTCCTGCAGTTTGTGTTTGTTTGTGCTGCTGACAT
TGCTATTAATGATGGCACTTTCCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations