header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15796
Transcript Name: serpine3-002
Previous Names: im:7152538-002, si:ch211-219a4.10-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035118|OTTDARG00000026449|ZDB-GENE-050309-223 serpine3|no_translation CH211-219A4.10-002 LG_ CR533429.7 Danio rerio protein_coding NOVEL, 885 bp
AATGAGTTGTCCTGGCGTGGAGGATCAGGGCGAGCGCACG
TCCTCCTGCAGTTAAAGCACAGCGCCTGAGTGACAGTGAC
AGTGACCGCGGGCTGAACATCAGCAGAAGAACCACAGCAG
CTCACACTCTCACACAGGACAATCCGGCAGATTTTGACGT
GTTGATCATGCCTCAGCTGTCTGCCTCATCACTGTTCATC
TGTCTGTGGCTGGTGGATCTCTGCCATGTGGCCAACAGTG
TCTTGAGCAGCAGCTTCAGTGATCTACACACACAGTTTGG
CATCAGCCTCTACCAGACGCTCACAGAGACAGAGAATAAG
TCCAACCTGATAGTGTCTCCGGCCAGTGTGTCATTGTGTC
TGGGTCTTCTGCAACTCGGGGCCAGGGGAAACACTCTGGT
TCAGCTCGAGGGTACATTGGGATATGATGTCAATGATGTT
CGTGTGCAGAACATTCTGTCTCGGCCACAGGGAGACCTGG
CTAACTCCAGCGAGGGCCTGCGGCTTCAGCTTGCCAATGC
CTTATTCATCCAGACTGGGGTAAAACTCCTGCCAGAATTT
ACCCAGCATGCTTTGGGATGGGGTAACACTAGTCTACTGA
GTGTAAACTTCAGTAATCCCAACCACACTCACAGTCGGCT
ACAACAATGGGCACATTACCAAAGTAAAGGTGAGTATGTT
TTGATTAGGCTGGTCCCTAAAACCACTAGATGATCATGAT
TTATATTTAGAATGACGGCAGAATAATAATCATCTCAGTA
TGTTCCTTGAAGATTTTTTGTGTAAATATATCAAATGTTT
GATCATTGCTAATATCTTAATTTGAACATCTTTAAAGACA
TCTTTTTTAACCCAGATTCCAGATTTTGTAATAGATGTAT
CTCTG

serpine3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA serpine3-002 885
serpine3-003 (1) 905
mRNA serpine3-201 (1) 1863
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
serpine3-002 Contained in:
OTHER serpine3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000035118 (1)
  • Ensembl_Trans:ENSDART00000134945 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH445660 (1) 907bp
    CITATIONS (2)