Transcript

traf3ip1-202

ID
ZDB-TSCRIPT-090929-15424
Name
traf3ip1-202
Previous Names
  • traf3ip1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034689 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034689|OTTDARG00000021678|ZDB-GENE-040426-1146 traf3ip1|OTTDARP00000027939 CH211-268B13.1-002 LG_none BX005108.8,BX897692.16 Danio rerio protein_coding KNOWN, 790 bp
TGGGACAGAAAGCTATCGCCAGGGCAACAGGAGAGTTTAG
CCAGCGGAAATCTTCTGCTAGCTGAACGGTAACGGCGATC
AATCACAGAATAAACATCTTACATCCGAAATACTGTTTTG
GTTTGATGCCATGAACGAATCGGTAGCCAAAAAGACCCAG
GAGACTCTGGGGAAAGTGATCAAAAAGCCTCCCCTGACTG
AAAAACTGCTCAGCAAACCACCGTTTCGATACCTGCACGA
CATTTTCAGCGAGCTCTCTAGTGATGAAGCTGTTAAACGT
GTGTTAGCGGGAGACAAGCTGGATCAGAAGGGCAAGCCCA
GCACCTCCAGATCCCAGGACAAGGAGAACAGAGAGGGCAG
AGAGCACCACCGAGACCGAGAGGAGAGGAAGGGCATCAAG
GAGAGCAGTGGGAGTCGAGAACAGAAAGATCCAGATCAAC
CCAAAGATCAAGAGAGCAAGAGGGACGACAAGGACCGCAG
ACGAGATGCTGAGAGGTCTGACAAAGGCCGAGAAAGAGAG
CGAACAAAAGACAGAGATCGAGACAAGGACAAGAGCCGCG
ATCGGGAGAAAGACAAGACTCGAGAGAAAGAGCGGGAACG
AGAGAAGGATCGTAACAGAGAGAAGGAGAGAGAGCGGGAT
AAAGATCGAGATAAGAAGAAGGAGAGGGAATCTCACAAAG
ACAGAGAACGGGACAAAGATCGTGAGCGCGAGAAACGGCG
GGAGAAAGAGAAGGACAAAGAAAGACCCAGAGAGACTGAG
GAGAAACTAAAAGACAGAGGCGACAGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations