Transcript

traf3ip1-201

ID
ZDB-TSCRIPT-090929-10211
Name
traf3ip1-201
Previous Names
  • traf3ip1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027664 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027664|OTTDARG00000021678|ZDB-GENE-040426-1146 traf3ip1|OTTDARP00000022657 CH211-268B13.1-001 LG_none BX005108.8,BX897692.16 Danio rerio protein_coding KNOWN, 2241 bp
GAAAGCTATCGCCAGGGCAACAGGAGAGTTTAGCCAGCGG
AAATCTTCTGCTAGCTGAACGGTAACGGCGATCAATCACA
GAATAAACATCTTACATCCGAAATACTGTTTTGGTTTGAT
GCCATGAACGAATCGGTAGCCAAAAAGACCCAGGAGACTC
TGGGGAAAGTGATCAAAAAGCCTCCCCTGACTGAAAAACT
GCTCAGCAAACCACCGTTTCGATACCTGCACGACATTTTC
AGCGAGGTAATACGCACTACAGGCTTTATGAAAGGACTTT
ATGTGGAAGCAGAGATGAAGTCAGATAACGTGAAGGACAA
AGACTCGAAAATAGCATTCCTTCAGAAGGCCATTGATGTG
GTGATGCTAGTCAGCGGAGAGCCCTTGGCTGCTAAACCTG
CTCGGATCGTAGCCGGACACGAACCAGAGAAGACCAATGA
GCTGCTGCAGGTCATTGCTAAGTGCTGTCTCAACAAGCTC
TCTAGTGATGAAGCTGTTAAACGTGTGTTAGCGGGAGACA
AGCTGGATCAGAAGGGCAAGCCCAGCACCTCCAGATCCCA
GGACAAGGAGAACAGAGAGGGCAGAGAGCACCACCGAGAC
CGAGAGGAGAGGAAGGGCATCAAGGAGAGCAGTGGGAGTC
GAGAACAGAAAGATCCAGATCAACCCAAAGATCAAGAGAG
CAAGAGGGACGACAAGGACCGCAGACGAGATGCTGAGAGG
TCTGACAAAGGCCGAGAAAGAGAGCGAACAAAAGACAGAG
ATCGAGACAAGGACAAGAGCCGCGATCGGGAGAAAGACAA
GACTCGAGAGAAAGAGCGGGAACGAGAGAAGGATCGTAAC
AGAGAGAAGGAGAGAGAGCGGGATAAAGATCGAGATAAGA
AGAAGGAGAGGGAATCTCACAAAGACAGAGAACGGGACAA
AGATCGTGAGCGCGAGAAACGGCGGGAGAAAGAGAAGGAC
AAAGAAAGACCCAGAGAGACTGAGGAGAAACTAAAAGACA
GAGGCGACAGAAAGATCAAGGCAGCGGAGGAGATCAGCAA
GTCAAAACCTCAGCCGGAGGTTGCAAGTAAAACACACCAA
GCTGAAACTGAAGAGGCTGAGAGTCCTTCCCGGATCCCAA
GGCCTTCATCAGCTAAAGGACAGCGGCGGAAGCCCAAAAC
AGGAGGTCAAGGTACTGAACAAGACGAGACAGAGAGTGAA
GGAGAAGCAGAAGCTCCTTCAGCAGAGAAACCAATTCCTC
TTGAGAATGGGGACGTTACAGATTCTGCCACTCTGCAAAC
AACACTCAGTAGAAGATTACCACGGCCAAGCAGTGCTCGA
CCAGCAGCTCCTCGTGTGAAGAGACAAGAGAGCTACACTG
ATGCCACTCCAGCTGAGAGGCTTGGCAGTGGCAAGACCCC
TGCATCCGTCATTCTGGATGGCAAGAAGCTCTCTGAAGAT
GAGGATGATGAAGATGGGCAGTTTGTGGTGGAGGAGGCAG
CTCCACCTCCATCTGATGTACCTGAAGTGGAGAGTAATTC
ACTTGAGTTGCAAGGCGATGACAAACATGGTGGACTTGTG
AAAAAAATCTTGGAGACAAAGAAAGACTATGAATCATCTC
CATCCTCCAAGTCAAAAGAGCAGGACCGGTCGCTGGTGTC
GGAGGCGTCTCGTAAGAAGGAGCGTGAACTGGTGGCAAGG
GAGATCGAGCGTCTGCGTTCCTCCATACAGACGGTGTGCC
GAAGCGCTCTGCCTCTGGGAAAGATCATGGACTACATTCA
GGAGGATATGGACTCCATGCAGAACGAACTGCAGAGCTGG
CGAAGAGAGAACAAGGAGAATGCACAGGCTCTGCTGCAGG
AACAGAGAATCACAGACGGTGTAGTGGAGCCTCTTAAAGT
GGAGCTCGCCGAACTGGAGCAGCTAATCAAAGACCAACAG
GACAAGATCTGCGCAGTCAAGTCCAACATCCTGAAAAACG
AGGAGAAGATCCAGAAGATGGTGTCCAGCATCAGCTTCTC
CTCGCAAACGTGAACACAAGACACTTCCCCAATGAAAGCT
GAAGCACTGAGCTCTTGTTAACAGACGTGGAGAGACAGCA
GAAGGTTACAGGTACAGTCAAGAGTCAAACCTCCACCAAA
ACCCTTCATGTAAGGTGCCTTCTGTAAGACCGGGAGATCT
GTTTGCGCTGGTCCAAACTCACGTCTGCAGTAGATTTGCA
CTCGTCACTTGCTTGAGAGATAAATGCGTGTGTGGTCACT
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations