header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15399
Transcript Name: sox1a-201
Previous Name: sox1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034663 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034663|OTTDARG00000026186|ZDB-GENE-040718-186 sox1a|OTTDARP00000027919 sox1a-001 LG_ CR392332.8 Danio rerio protein_coding KNOWN, 1929 bp
ATTGGCCGCTCGCTCATTTTAATCGCTGTCAAAACGCATC
ATATGGCCGCCGCTTTAACTAACTCTTCAACTCCACTAGG
AAAAGTAACTCAAATGCACGTTCAATTAATGTGGATGTGA
AGCGGCAGTCGGAGACGACACTAAACTGGCTACAGGAGCG
AAAAGAGAGCCCGAAATTGTCAGCAAACGGTTGGGAATAA
GCTGAATTCCACACTTCATCGGAGCTCCACTGGCTCGTGA
AGCACCTGTTTCAAGCGGACTACGGAGCGCCGAAAGTTCA
TGCTTTTTCTCTGCTAGTTGAGAACTTTTAAGCCACTTGA
ATGTATAGCATGATGATGGAAACGGACCTTCATTCCCCGG
GACCCCAAACCAACACGAACCCGGGGCAAACGGGTCCAAA
TTCGGGGAGCAAAGCCAATCAAGACCGCGTAAAGAGACCC
ATGAACGCGTTTATGGTCTGGTCTCGGGGCCAGCGCCGAA
AAATGGCACAGGAGAACCCCAAAATGCACAACTCTGAAAT
TAGCAAAAGACTCGGTGCTGAGTGGAAGGTGATGTCAGAG
GCTGAAAAGCGGCCCTTTATTGATGAGGCGAAGCGGTTGC
GAGCCATGCACATGAAAGAGCATCCGGATTACAAATACAG
ACCGAGGCGCAAAACCAAGACCCTGCTTAAAAAGGACAAG
TACTCGTTGGCGGGTGGCTTGCTCGGCGGTGCGGGTGGTG
GAGTCGGGATGAGTCCTGCGGGGGTCGGCCAGAGGTTGGA
GAGTCCTGGGGGTCACGGAGGCTCGGCCAGCGCTGGCTAC
GCGCACATGAACGGCTGGGCGAACGGCACTTACTCCGGCC
AGGTGGCTGCCGCGGCGGCGGCCGCCGCGATGATGCAGGA
GGCGCAGCTCGCTTACAGCCAGCACCCCGGCAGTGGCTCT
CACCATCACCACGCTCATCACCATCACCCGCACAATCCTC
AGCCCATGCACCGCTACGACATGACTGCACTCCAGTACAG
CCCCATCTCGAACTCCCAGAGCTACATGAGCGCGTCCCCG
TCCGGCTACGGTGGGATATCATACACGCAGCATCAGAACT
CCAGCGTCGCGACTTCTGCCGCCATCGGCACGCTGAGCTC
GCTCGTCAAGTCCGAACCCAATATCAGTCCCCCGGTTACC
ACGCACTCCCGAGGCCCTTGCCCCGGAGACTTGAGAGAGA
TGATTAGCATGTATTTACCGACCGGGGAGTCCGGGGATCC
GTCTGTGCAGAGCAGACTGCATGCCTTACCGCAGCACTAT
CAGAGCACGACTGCCGGAGTAAACGGAACTGTCCCACTGA
CGCATATTTGAAACAGCTGATGGAAAGCGATGGGTAACGC
GCATTCAGAAACACTCCACCAAAAATATTTACCTCTTTTT
TTTAGATTGTCATTGAACTACTTTTGTACAGAATGTTTTA
TGATGTTCTTGTAAATTAAAGGTAAATATTGTTTCGATTG
CAGTTCGGAGAGAAACTGAGGTCTTATATCAGATGTATCA
CTTTCAGTGAAGCATTGTTTAAATATGACGTCTTTAAAAT
GATCCTGACAGCGTTTCTGGCCTCGCCAAGAAATATGCGA
CACACTGTTATTCTTTAAATATTTAAGTTTCTGTGCAGAT
TGACTTTTAAGTTGATAATGACAAAAGTCTAGCGTGAAGA
ACTCAATGAAATGTTTTTGAGAGCCCATAAAGAGTTTCCT
GCTTATTACATTTACCAAAACGTTTGTATACGTGAATTAA
TGTACCAGATTTATGTTGTAATATTTCTTGTAAATTGTGA
ATAAGTTTTAATATTTCAAAAGGCTGGCACGTCACTGCTG
CTGTACATAATTTATGACATGCATTACTGCCAGTTCAAAT
CTTAACCTTGCGTTGATTCATGGTCTAAATAAAATTGGAG
AAAAAGTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sox1a-201 Contained in:
[BAC] DKEY-58D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034663 (1),  Ensembl_Trans:ENSDART00000102021 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC096992 (1) 1947 bp
GenBank:BC076326 (1) 1946 bp
CITATIONS (2)