Transcript

tns1b-002

ID
ZDB-TSCRIPT-090929-15332
Name
tns1b-002
Previous Names
  • tns1-002
  • si:ch211-148j1.1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034550 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034550|OTTDARG00000026106|ZDB-GENE-030131-6933 tns1b|no_translation CH211-148J1.1-002 LG_ AL929460.14 Danio rerio protein_coding NOVEL, 540 bp
CTTCCCCACTGTGACGGTACTCCTGTGGAAATGATTTAGG
GCAGAAGAGTTCAGCTGATGGCCATGCATGCAATGTGCTG
TACATCAACTCTGTGGATATGGAGTCTTTGACTGGACCTC
AAGCCATCGCCAAAGCCATTTCAGAAACCATGAACGCCAG
TCCGGCACCCTCAGCCACCATTGTTCACTTCAAGGTGTCG
GCACAAGGCATCACACTCACAGACAACCAGAGAAAGCTTT
TCTTCAGACGTCATTATCCCATCGGCACAGTCACGTTCTG
TGACATTGATCCACAGGAGAGGAAGTGGAACAAACCAGAG
GGTGGCACTGCCAAATTCTTTGGCTTTGTGGCTAGAAAGC
AAGGCAGCACGACAGACAATGTCAGTCACCTGTTTGCTGA
GATGGACCCAGATCAGCCGGCCACCGCCATCGTCAACTTT
GTCTCTAAAGTGATGATCAGCTCTCAGAAGCGGTGAAGCT
CTTCACGCAGCACTGCTTTCCAGAGGACACTTTCCTTTCG
CTCTCTTTGGATTATATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations