Transcript

tns1b-202

ID
ZDB-TSCRIPT-090929-15331
Name
tns1b-202
Previous Names
  • tns1-001
  • tns1b-001
  • si:ch211-148j1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034549 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034549|OTTDARG00000026106|ZDB-GENE-030131-6933 tns1b|OTTDARP00000027844 CH211-148J1.1-001 LG_ AL929460.14 Danio rerio protein_coding NOVEL, 2444 bp
GTCGATCTCCTCCAGGATTGGCTAAAACACCACTGTCCTT
TCTGGGCCTGAAGCCCCACAACCCTGCTGAGATCCTGCTC
AACCAGACAGGCTCAGAGCCTCGTAGTTATGTGGAGTCTG
TGGCGAAGGCAGCAGCAGTACCTGCATCTCCAACATATGA
CAGCGACAGCTTAGCTCGTCCTGCCGGACCGTCCCATGCT
TACAATGCTCCACTTTCCTCCAGCAGCCCCATTCAGAACC
CAGATCCAGTTGAAAGCACATTGGCTGACAGCGGGGTCGG
GATGAATTCTTTATCCCAGGCTGCTGTCGACATTTTCCAT
TTCCAGCCCTCCGAAATCCCATACCAACCACCACCACCCC
CCTACCCAACCTCCATGTTGGGTAGCTACATCAGCCCTTC
TCCAGCAGAGGCCATGCAAAATAATACCACCACCATCCAG
CCACTTTCTGGAAGTCCTGGGACAAGACACCACACCATCC
TTTCTGACATGGCGTCCGTTCCCAACTTTCAACACAGATT
AGCAAATCAGGATGGTCCCATACTTGGGCGACAGCAGGCT
CCAGCTAATGGTCATGTGCCTGGAATTGCTGGTAGTCCAG
TGCAAGGAAGACACACTATGGTGTCCCAGGGTACACAAAG
CAGTCCCATACTGAGCAGACAGTATCCTGTCACCCAGGGG
ATTCAGAGTAGTCCAATTCTCAGCAGGCAGCCAATGGGAC
AAGCTGTCCAGAGCAGTCCAGTCCTCAACCGACAGGCATC
CCTGAATCAAGCAAACCAAAGCAGTCCAGTGTTGAGTAGA
CAGCAGTCCATTACCCTACCCAACCAAGGCAGCCCGGTCC
TAAGCAGACAGTCCTCGCTTAGTCATCCCAGTCAGGGTAG
TCCTGTACTAGGACGCCACCCTTCCCTAACACAGGGTAGC
CCCAGCCTGGATAGGCATCCGATGTACAGCGGTTACACCA
CTCCAGAAGAGCGACACGGAGCTCTGTCACGCCAAAGCAG
CTCTTCAGGATACCAGCCGCCATCTACACCGTCTTTCCCA
GTTTCTCCAGCAGGATACATCGAGGGAGCGGGATTCAGAC
AGGGGAGTCCTGCTTTCCAACCTCAGTTGCCCGAAAAGAG
ACGCATGTCCAGCAGTGACCGCACCAATGGTGGCCTGTCC
TATGGGACGCTCAATGGGAAGATGTCCTCACCGGTGTCCA
GTGGCGGCAGCACTCCGAGTGTTCATTTCTTCCACACACT
CCCCGATTTCTCCAAACTCAACATGTGTGATGGAAGTCCA
GAAACCAGAATGAACGTGAAGTTTGTCCAGGACACGTCCA
AATTCTGGTATAAACCAGATATCTCGAGAGACCAAGCGAT
TAACATGCTGAAGGATCAAGATCCTGGGGCCTTTGTGATT
CGGGACAGTCATTCATTCAGAGGAGCCTACGGCTTGGCTA
TGAAAGTGGCTTCACCACCTCCAACCACTCAACCTACAAA
GAAAGCTGGAGATGTCACTAATGAGTTGGTGAGGCATTTT
CTAATTGAGACGAGTCCGAAGGGTGTGAGACTGAAGGGCT
GCCCCAACGAGCCGTACTTTGGCTGCCTGTCTGCGCTGGT
CTACCAGCACTCCATCACTCCACTGGCACTGCCCTGCAAA
CTAGTCATACCAACCAGAGATCCTCTGGAAGAGTCACCTG
AGATCGCAACACCAACCAACCCGGCGGCAGATATGCTCAA
GCAGGGCGCAGGGCAGAAGAGTTCAGCTGATGGCCATGCA
TGCAATGTGCTGTACATCAACTCTGTGGATATGGAGTCTT
TGACTGGACCTCAAGCCATCGCCAAAGCCATTTCAGAAAC
CATGAACGCCAGTCCGGCACCCTCAGCCACCATTGTTCAC
TTCAAGGTGTCGGCACAAGGCATCACACTCACAGACAACC
AGAGAAAGCTTTTCTTCAGACGTCATTATCCCATCGGCAC
AGTCACGTTCTGTGACATTGATCCACAGGAGAGGAAGTGG
AACAAACCAGAGGGTGGCACTGCCAAATTCTTTGGCTTTG
TGGCTAGAAAGCAAGGCAGCACGACAGACAATGTCAGTCA
CCTGTTTGCTGAGATGGACCCAGATCAGCCGGCCACCGCC
ATCGTCAACTTTGTCTCTAAAGTGATGATCAGCTCTCAGA
AGCGGTGAAGCTCTTCACGCAGCACTGCTTTCCAGAGGAC
ACTTTCCTTTCGCTCTCTTTGGATTATATTTTGAGTTTCT
GTATGTTTGGGCTGTGTGTGAATGTGAACGTGAGGAAGGG
CTATTGGGACGGCAGTGAGGATGATGGACAGAGGAAGTGC
AGAGTGGGTGAAGAGGAGTGACGTACAGTATGGATGGGAG
GTGATCTTCATCTCGGAGCAGCAGATGTGGGAATGATGTC
AGTGATTTTGTTGCTTTTTTTAAGAAAAAAAAAGGAAATG
TAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations