Transcript

frzb-201

ID
ZDB-TSCRIPT-090929-15322
Name
frzb-201
Previous Names
  • frzb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034538 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034538|OTTDARG00000026097|ZDB-GENE-990715-1 frzb|OTTDARP00000027835 frzb-001 LG_ CR513785.10 Danio rerio protein_coding KNOWN, 2994 bp
CCCTCAGCATTTCCACAAGAGAATTTCTTCAGCTTTTTTT
CTTAACTCCAATTATTTCATCGACAATTTCAAGAAGAGAT
GAGCTTTTGTGCTCTACGCATCCGATGCATTCCCTCAGAA
TGGTGAAGTTAGTTTGAGGAACTTTCTTTTGGCACCGCCG
GGGAGCTTTTTACGCGCTAGAGTCTCCAGAACACCTCCGC
ATGTCATTCTTCTATCAACTCCGCTTTTTTTAATCATTAT
TTTTTTATATTTAATGCAAAACATGTTTTCCTACGAGATG
TTCATCTGCGTCCTGGCCTTCGCATGTCTCCTGGAGATCC
CGCGGGGCACCGGAGCCGCGTCCTGCGAGCCCATCCGCAT
CCCCATGTGCAAATCCATGCCCTGGAACATGACCAAGATG
CCCAACCACCTCCATCACAGCACGCAAGCCAACGCCGTCC
TGGCCATCGAGCAGTTTGAAGGGCTCCTGGGCACTCAGTG
CAGCGCGGATCTGCTGTTCTTCTTGTGCGCCATGTACGCG
CCCATCTGCACCATCGACTTCCAGCACGACCCGATCAAGC
CTTGCAAGTCCGTGTGCGAGCGGGCCAAGTGCGGCTGCGA
GCCGGTCATGAAGAGGTACAACCATACGTGGCCGGAGAGT
CTGGCCTGCGAGGAGCTGCCGGTGTACGACCGAGGGGTCT
GCATCTCACCTGAGGCCATAGTCAAAGCGGAGGGGCCAGA
TAATTCTTACTACCAAGACCCTGCGAAATGTAACCCTGAG
GGAAACCCAGACTTCCCAATGGATTCACACAATACTAACT
GCAAAGGAGCAAATGATCGGTGCAAATGCAAGTCTGTGAA
ATTTAATCAAAAGACATATTCAAAGAATAATTACAATTAT
GTGATTCGTGCAAGAGTGAAGGAGATCAGGATTAGAAATC
ATGACCTGAGCGCCATTGTGGAGGTCAAAGAAGTTCTGAA
GTCATCTCTGGTCAACATCCCTCGAGACACGGTCACTCTG
TACTATAACTCCGGCTGTCTGTGTCCTCCGCTCACAGCCA
ACGACGAGTACATCATCATGGGTTATGAAAATGAGGAGCG
CTCCAGGCTGCTGCTCATCGACAGATCCATTGCACAGAAG
TGGAAAGAGAAAATAGGCCGGAAAGTAAAGCGCTGGGACC
AGGCTGCAAACGGGAGGAGGACCAAATGGAACCACCACTA
AACTGTCCTTGGAAATAAACCACACAGACAAGCCTGAAGA
GCAGAAGGAGCAGAAACTGAAAAATTGCACTATTGTACTT
TGTTTTGTTTTTTCATTTTGTGTGTGTGTGTGTGTCGCTT
TAATTTTTATTGTTGTTATATTCTCATTAACAAATTGTTG
CCTTTGCACAAACAAAATGTTGGCTTGACATTGCTGTGTT
AGGAATGGGTGGCGAGCAGTGTTGGGTAAGGTTACTTTTA
AGAGTAATACATTACAGTCTTGAGTCACTTTTTTTCTAAT
ATCTAAAAATGTTATTTAGGGGGGAAGGTAATGTAAAAGT
ATGTATTATGTTATTTTTGCTTGTTTATATCGAGATTAAG
AAATGAATGGTCAAATGGTCAGTTCACCCAAAATAAATGA
TTTTTAAGTAGCTAAATGTGTTACTTTTTAAAGAATGTAA
TGTAAAAGTACACTGTACACTTACATTTTTAAGCTGAATC
AAATAAACCTTTTAAGTCCATAATACTTATATTGTTAAAC
TAACTTAAAACAGCTTGCATAACCTATGACCTAAAACATG
CTGTCAGGGCTAATTGATCATATTATTTTTTACTGTGTAT
GAATTGTTATTGTTATTTTTAAAGAATAAGATAGGCTCAA
AGGATCAGTTTACCAAAAAAAAAAAAGATTTTTAATTAAC
TAAATGTGTTCCTTTTTAAGAATGTAATGTAAAAGTACAC
AGTAAAAAATAGACGCAACTTAAAATTTTAAGGCAACAAA
CCTCAGGACATTTTTGAGCTAACTTGACTTAAATCAAGTC
AAGTGCAGTAATTGGTTTGAAAGTTAAGTCATCTCAAAAA
TTTCCTAAATTTTTAATTTGAGTGTATTGTTATTGTTATT
TTTAAAGATTAAGACAGATTTAAAGGGTCGGTTCACCTAT
CCCTTTAAGATTGTAATATATCCCTTTTAAAAGTAACTTT
ACTCAACACTGGTGGTGAATGTCGGGCAGCATTTTTTGCC
CATTAAATTTAAAGGTATTTGAGGTGCTGGTGTCATTTTG
TCCTACCTTGTCAGATTGTCCTACCTCCCATTTAAAAAGT
AGGTAGCACATTTTGATGATGCAGTATGCAACCAATCAGA
TTTTGCTACCAGTATCAATTTTTTAAAGTGGAGTAGTGTG
ATATGAAGCTGTAATATCGACCTAACCTATGCACCTAATA
ACCCCAATCTCAGAACCATTCAGATACAGTGTTCAATAGC
ATAATCTGATGGGTAGGATAAAATGTCAGGACACTAGTTC
ACATTGACATGATGCAGCTCTCTGCTTACAACAGCAAACA
AACGCGCTCTCATGCTGAATTTTCCCCTCAGGAGGTTTTA
ACGTTCTTCACAAGAACAATGAACAGCGAGAGAAGCTGAG
AGAGAATCTTTTTGGCAGAAGCACAGAGACGTTGAGATGA
TCCAAGACTTAGGAGTGTAACGTTATTGCGGACGACGAAA
ACAAGCTTTTGGGCTTTCTGAATGATGTTCCTTTTAAAGC
ATTTTACATGATAATTCCTGTAGTTCTGTTCTCTTGTAGA
TGTACGCTTGATCTTAATTGTCATTTGAAGTGTCATGCAA
TTGAAACTATTGTACAAACTGTACATAATGCTGCAAAAGT
CCATTATTCAGCCTGGAACTCTTCACGGATGACATGAGCG
TGTTTGTATGCGTCGCAAATGACGTCGATTTTGCAAACAG
ACATTTTGTCTTCGGAGACAAACAAGAAGATTTCTTCACT
GTGTTTTGGGTTCAAGTAAAGAGGTTTCATCTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations