Transcript

lct-201

ID
ZDB-TSCRIPT-090929-15311
Name
lct-201
Previous Names
  • lct-001
  • si:dkey-79p17.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034526 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034526|OTTDARG00000026088|ZDB-GENE-081104-434 lct|OTTDARP00000027825 DKEY-79P17.2-001 LG_ CR394556.10 Danio rerio protein_coding NOVEL, 5703 bp
ATGATGAAGATCCTAGGGGGATTTCTTTCTCTGGGTGTGT
TGGCTATTTTCTGGAGCTACATTAATGCAGATGAACAGGA
GTTCATGCTACTTGCGGGTCCTCTGACCACCAGCCAGAAT
TTACCTTCAGAGGAACAATATGTGTTTAACTGTAGAGGTC
CACTGCCACAACAATCCAAAGACTACTTCTTGTACCTTCA
AAGGAGAGGGGTGACCAACTTCAAGGTTCTCCTGTCTTGG
TCTCATATTCTTCCTACAGGTGATGCCAACCAGCCACATG
AAGAAACTGTGATGTGCTTTAAGACGCTTGTACAACAGCT
GACTGAATCAGGCATCAAACCTCTGCTGGTTCTCCATCGT
TCTGCAGTACCAGAACTCTTCAGAGCCAAATATGGAGGCT
GGGGGAATCCATTGCTAGTGCAGATTTTTGAGCAGTATGC
AGGATTTGTGTTCAGCACATTTAGGGATCACGTTGACACG
TTCGTCACATTCAGCCACCTGCATGAGCTACAACATGAAG
AACTTCAAAATGCTCTCCAGTCCCATGAAAATGCTTACAA
AGTCTGCCATCAACAGTTCAAAGGGCTTCGTTTGTCTCTT
GGAATCAGAGCTAGTCATGCTACATCCATTTATCAAATGG
GATCAAAAATTATGACACATGTGGATTTCCTCTCAGTGCA
CATGCAGTTCAACTGCAAAATGCAGACAGCTCTTACTGAG
GAATTGAGAAAAGTACAGATAGTCAGCGGTCAAAAGTCCC
TCCTTATTTATCAGCTGACAGTGAATGATTGTGATGGATA
TGAACATGATTTCCAGCCACTTACTGTAGTTCTTGGAGTT
TTACAGAACAAAGATTATAAAATCATAGGCTGTGACATCA
CACATGTTTTTGAGAAGCTAGATTATGAAGAAACACCCAG
AAGTCTGCAGAAAGAAGATGCTATGTCTGTCTTCAATCAG
AAATCAGCTTCTGCATTCTCATATCAGAAGGTTTGGGAGA
AATTCAAAACTCAGACTGAAGCTGAGCGGGACCAGTTCCT
CAGTGGTTCCTTCCCAGTTGATTTTGAATGGTCCGTCTCC
AGTGAGAGTTTCAAAGTCGAAGGTGGATCAGCAGAACACG
GGAAGGGTGAAACCATATGGGACCGTTTTAACCATGAGGC
CGGGGTCAACGAATCCATTTTGGGCTGTGATAGTTATCAC
AAGGTGGACTATGATGTGTATCTTCTTAGAGGCATGATGG
CACCAAATTATCAGTTCTCAATTTCTTGGGCTCGCATTTT
TCCCACTGGACGCAAAGAAAGTTTTGTTGAAAAGGGGGCT
GCTTATTATGATAAGATGATTAATACACTCCTGCAATCAG
GAATCGAGCCCACTGTTACCCTGCATCACTGGGACCTTCC
CCAAGCTCTACAGGAATCAGGAGGCTGGATTAATGACTCC
ATTGTTGAAGCTTTCAAAGAGTTTTCTGACTTCTGCTTCT
CTCGTTATGGAGACAGGGTCAAAACATGGGTCACCTTTGG
CAGTCCTTGGGTAGTGAGCAATTTGGGATATGGAACAGGC
GTATATCCTCCAAGCATTAAAGACCCAGTATCTGCCTCTT
ACAAGGTGACGCACAATATTCTGAAATCTCATGCTGAAGC
CTGGCATATTTATAATGATAAATACAGGAAACTGTATGGT
GGAAAAGTGGGCATTGCTCTGAACTCAGATTGGGCAGAGC
CGAGGGATCCCTCAAGTGATCAGGATGTAGCAGCAGCTGA
GCGTTATCTAAACTTCATGCTGGGCTGGTTTGCTCATCCA
ATATTTGTAGATGGAGATTATCCAGCGGTGCTGAGGGAGC
AAATTGAGAAAAAGAAAAAATTGTGTGACCAAGACCTGGC
AAGACTCCCTGTCTTCACCGAGGCTGAGAAACAAAGAATT
CAAGGCACAGCTGATTTCTTCGGACTAAACCACCAAACAT
CCCGACTGATTAGTGAGAATTTGACTAGCTGTGATGCAGG
GCCAGATAATGTTGGGGACTTCCAGGCTCATATTGACCCT
ACATGGCCCACTACATCTTCTGACCAGATCCAGTCTGTTC
CATGGGGGCTCCGGCGGTTATTGTATTACATCTTTTTAGA
GTACACATCTATCACAAAGGTGCCCATCTATATCACAGGA
AATGGAATGCCAACTGAGTATACTGGTGACGGGATCAATG
ACACTCTGCGTGTTGACTATCTCAAAGCTTACATTAATGA
AGCAATGAAAGCTGTACATTTGGATGATGTTGTCGTTCAG
AGGTTTACAGTCCAGTCTCTAATGGATGGATATGAGGGTC
CTCCAGGTTACACTCAACGGTTTGGTTTGCACTATGTGAA
CTTTGATGATCCTGACAGGCCAAGAACCCCTAAAGCATCA
GCATACTATTACTCAAAGGTGATTGAGAGAAATGGATTTG
CTGAGACTGCAGCAAGCCCTAAGATGCAAATCCATGGAAA
TCAAGTCGAAAGTAGAAGACTCCCTAGTTTGCCTCCATCT
CAAGTGCCTTCAAAATCCAAGGTTGTTTGGGAAAAGTTTT
CACCTCAGACCAAATTTGAGAGGCAGCTTTATCACTATGG
AACATTTTCAGAGGGATTTCAGTGGGGTGTCTCATCTTCA
GCTTATCAAGTTGAAGGTGGCTGGAATGCAGATGGAAAAG
GACCAAGTGTTTGGGATACTTTCACTCAGAAACCTGGTAA
TATCCCAAACAATGCCAATGGCGATGTTGCATGTGATAGC
TACAATAAAGTAGATGAGGATCTACACATGTTGAGGGCCC
TAAAAGTGAAGACTTACAGATTCTCATTGTCATGGTCTCG
GATCTTTCCAAATGGCTATAAATCTTCCCTTAACCAGAAG
GGGGTGGATTACTACAACAGGCTCATAGATGGTCTCATAG
CAAATAATATCACACCCATGGTGACTCTCTACCATTGGGA
CCTGCCGCAGGCTTTACAGAACATCCATTGGGACAACACT
GAAATGATTGGCTTATTCAATGAATATTGTGACTTCTGCT
ATGCAACATTTGGAGATAGGGTGAAGTTTTGGATCACCTT
TAATGAACCCCAGACGATTGCATGGTTGGGATATGGGCTG
GGTCAGATTCCACCTAACGTGAAGCAACCAGGAGATGCTC
CATACAGGGTTGCACACAACCTCCTGAAAGCTCATGCACA
AGCTTATCACACATATGATGAGAAATACAGGGCATCTCAA
GGTGGTCTGGTATCCATTAGTCTGAATGCTGAATGGGCAG
AACCCCTGGATGTCAACATCCCTCGAGAGGTTGTGGCTGC
AGACCGAGCCCTTCAGTTCCAACTAGGTTGGTTTGCACAC
CCCATATTTAAAAATGGTGACTACCCTGAAGCCATGAAGT
GGCAAGTTGGCAACAAGAGTGAACTGCAAGGCTTGAAGGA
ATCCCGCTTACCTCATTTTACTGACCAAGAAAAAGCCTTT
ATCCAAGGAACAGCTGATGTATTCTGCATTAACACATACA
CTACCAAAGTCGTGCGCCATGTGACCAGCAGACTTAATAT
CGAATCCTATCAGACTGACCAGGATATTGAGAAGGACAAG
GCAGATGGCTCTGAAAATACAGCTGTTAGTGAGCAGAAAG
CTGTTGCTTGGGGACTCAGGAGACTTCTCATTTGGTTGAA
AGAAGAGTATGGAAATCCTGAGATTTATATTACGGAAAAT
GGTGTAGCTACAGGCACTGCCATTACGACAGATGACACTG
ATAGAATATTCTACTTGAAGACCTATGTTGATGAGGCTCT
TAAAGCACACAATTTGGATGGAGTACGTGTTAAAGGATAC
ATTGCTAGTTCTCTCATGGACTCCTTTGAGTGGCTAAATG
GCTACAATGTTGGCTATGGACTTCACCATGTGGACTTTAA
GCATTCAAGTCGACCAAGAACCCCAAAGCGCTCAGCTCAC
CTCTACTTTGATATAATGAGAAATAATGGCTTTCCAATGC
CCGTGGAGGAAAAAATGCTATATGGACATTTCCGAGAGGG
ATTTGTATGGAGCACAGCAACCGCTGCATATCAGATAGAG
GGCGCCTGGAGAGCTGATGGAAAAGGCCTAAGCATTTGGG
ACAAATTTGCACACACTTCTTTAAAGATATCCCAAGATGA
AAATGGTGACATTGCCTGTGACAGCTACAACAAGATCGAA
GAGGATATCGATAATCTCAAAACACTGAGGGTCAACCACT
ATCGATTTTCTATTTCATGGCCCAGAATTCTGCCAGATGG
AACAAACAGAAAAATAAATGAGGCTGGGCTCAACTACTAT
CACAGACTGATAGATGTTCTCTTGGCAGCCAATATCAAGC
CACAGGTGACTCTGTACCACTGGGATCTGCCACAAGCTCT
CCAGGATGTCGGTGGCTGGGAGAATGACACTATTGTTGAT
AGATTTAAAGACTATGCTGATGTTGTATTTAACAGTCTAG
GAGACAAAGTAGAGTTTTGGATTACTATAAATGAACCCTA
CAATGTTGCAATGGTTGGACATGGCTATGGAAGTGCAGCA
CCAGGTATAACTTTCAGACCAGGCACTGCGCCATATATTG
TGGCACACAACCTTATTAAGGCTCATGCTGAGGCCTGGCA
TCTGTATAATGATAAGTATCGTGCAAAGCACGGTGGGATT
GTTGGCATCACTATAAACTCTGACTGGGCTGAACCAAGAA
ATCCATACAAACAGGAAGACGTAGATGCTGCCAGGCGTGT
GGTTCAGTTTCAGCTTGGTTGGTTTGCTCATCCAGTGTTC
AATGGAGATTACAGTGATTTAATGAAGGATATTGTTCGAG
AAAGAAGTCTGGCAGCTGGCCTACCTAAATCAAGGCTTCC
AGAATTTACCCCAGAAGAAGTAGCAAGAATTAAAGGTACT
CATGATTATTTTGGATTCAACCACTACACCACTGTTTTAG
CCTATAATTTTGACTACAAGGATCTCCAGCACTATGATGC
AGACAGAGGTGTAGGAACTGTTACGGATCGTACATGGCTA
GATTCCGGATCCTTTTGGCTGAAAGTAACTCCTGTGGGAT
TCCGAAAGATTCTGAATTTCATTAAGGAGGAATATGGAGA
CCATACTATTTACATTACAGAAAACGGGGTGTCAGAACGA
GGGCCAGTCAATTTGAATGACATCCCCCGAATCCACTACT
ATGATAACTATATCAATCAGGCCCTGAAAGCATATATGCT
GGATGGTGTGGACATCCGTGGTTACGCTGCCTGGACATTA
ATGGACAATCTGGAATGGGCAACAGGTTTTGATGATAGAT
TTGGCCTCTTTTATGTCAATCGATCAGATCCCAATTTACC
ACGTATTCCTAAGAAATCTGTTTGGAACTATGCTACTATA
ATCAACTGCAATGGCTTCATAAGCCCAGAAGAACGTCCAC
ATAAATGTCAGGTCCATGAACCTGAAGACGACACTCCGGG
AATTACTACTATACCTCCACCTGTTGAGGAACTGTCGATC
AGCTTCTTGGGTTTGGAAGTGTCTGTTTCTGATGCTGAAC
TTGCTCTTAATGTCCTCTTCAGTCTCTCTATTATTGCTGC
CGTCACTGTTATCCTCTTGGTGTATGGACTTGTCAAGGCC
TCCAAAAAACAAAAACATCCTGCAGGGGAATACATTGACC
TTGAGAAAAAAGACAAGTTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations