Transcript

cerkl-201

ID
ZDB-TSCRIPT-090929-15272
Name
cerkl-201
Previous Names
  • cerkl-001
  • zgc:162213-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034481 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034481|OTTDARG00000026059|ZDB-GENE-070410-38 cerkl|OTTDARP00000027793 DKEY-165L22.1-001 LG_none FP102862.4,FP102928.5,CR753862.32 Danio rerio protein_coding KNOWN, 2043 bp
GGAGACGCGAGGAACTTCCTCAAGAGCCTAGCGACCGGGA
GCGGTAAATTAATACACACAGGCGAGTTTGCCCTCAAAAC
ATACACACTATGCTTGAATCCCCGTGTAAATCGATAAGTG
TCCTCAACGCGTGGTCGGAGAGTCAGGAAGAGTTGCGCGA
GACGCAACCGGTGTCTCCTCACGGGACGGAGAAGCGAGTA
AAGACAAAAAAGAAAAAGAGAAAACAGAAGCAAAGTCAGA
AGCGCTCCGTTTCGGCCCCTCAGTTATGCCCCGAAGAAGA
CTACAAGGAGCGAGTAGAAACTAAATACAGACCGGACGAA
CCGATTGTACGAGGAATCTTCCAAATTGAAAAAAAGAGCC
ACGACGTAGTTCTTACGACAACGCGGGTAACATGGACGCC
CATTCAGCCCGAGACCCCTACAGCTGACCGTGATCTGAAG
AAGCAGGAGGAGTATGTGGACCTTAAAGACGTGTTTGCAG
TGAAGGTAAAGCGGCGGCGGTCAGCTGGACAGCAGTCTGG
TGGGACCCTTCTGGGAATCACACTCTTCCAATGCAAGAAG
AAAGGCCTCAAACTGAAAGATCATGCCATCCATCTCAACA
ACCTGAGCGTGGACCACTGTGAGATCTGGTTCAAAACCCT
CAAAGAGCTCCTCAACGGTTTCAAGAATCGTCCCAAGTCT
CTCAAAGTCTTTGTGAACCCCATCAGTCATAAGAAAGAGG
CATACCAGATCTACCTGGATGAAGTTGCTCCGCTCTTCAA
ACTCGCTGATATACAAGTGGATGTCACCATCACTGAGAGG
AAGGGCCATGCTCTGTCCATTCTGAAAGACTGCAGCTTGG
AAGACTATGATGGTGTGGTGTGTGTTGGGGGAGATGGCTC
TGTTTCTGAGGTGGCCCACGGGTTGCTTCTCCGGGCCCAG
ATGGACGCTGGGAGGGACACAGACTCCATCTTCACGCCTG
TCCAAGCAGCACTTCCTCTCGGCGTAATACCAGCAGGTTC
TACAGATGTAGTGGCGTGTTCTGTTCATGGAATAAGACGT
GCTGCGACTGCGGCCTTGCACATCATCATGGGTCACCATC
AGCCTGTGGACGTGTGCAGTTTCAGCTGTATGGGTCGTCT
GCTGAGGTTCGGCTTCTCTGCCATGTTTGGTTTCGGTGGG
CGGACACTCGCATTGGCAGAGAGACACCGCTGGATGCCAC
CCAGCCAGCGCCGCGAGTTCGCTCTCATTAAAACACTGGC
AAAGCTCAAACCTGAAGATTGTGAACTGTCCTTTTTAACC
GCCAAAGGAGCTGAGGATCAGAAAAAAGCTGAGCTGAACG
GAGATGGAGGAGACATTTGTGAAGGTGACTGGCAGAGCAG
AAAAGGTCTGTTCCTCAATATCAGCATCATGGCCATTCCC
TGTCTGTGCTCCATGGCCCCCAGAGGCCTGGCTCCAAACA
CCAGGCTGAACAACGGCAGTATGGCGCTGATATCAGTTGG
CAACACCTCCAGGTCAGAGTTCATCAAGCACTTGAAGAGA
TACAACAGCACAAACAACCAGTTTGGCTTCTCCTTCATTG
AAACTCACAGTGTGAAGGCGGTCAGACTTCGGCCGAGCTC
TCAGAGCAGCTGGACTGATGACGTCTCAGAGGAGAACGAG
GAGAGCGATTCTAAAAACACACCCATCATCTCCTCTGAAG
GGACGTACCCCTGGAACATCGACGGAGATCTGCTGGACGT
CCCGTCTGAGCTCCTCATCAGAGTTCACCCTCAGCTCCTC
ACACTCTTTGGATCAGACGTGGAGGAGGCCGAGGAGACGC
CGGTGAAATGCAGCTGTATCTGAACACACACTCATACACA
CATGCACACAGAGAATTGCTATTAAGAACTCAACAAACAA
ACCGCACAGAGAAATGCTTTAACATGTAAAGAGAACATTT
TATGACAACACAAAAACACACAGTACATTCCAGTGCATTA
CAACTTAAATAAACCAAAAGACAGTTTTTAAACAAATTTG
TATCATTTTTAAAGACTTAACTTAATAAACATACACAGAA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations