ZFIN ID: ZDB-TSCRIPT-090929-1518
Transcript Name: sema3c-201
Previous Name: sema3c-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009531 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009531|OTTDARG00000008337|ZDB-GENE-050513-5 sema3c|OTTDARP00000008196 DKEY-105O6.1-001 LG_none BX537168.4,BX897665.7 Danio rerio protein_coding NOVEL, 2141 bp
AACTGCAGAAAACCCAGTCCTTTGAGCACTACTCTCTATC
TGAGAAGGCCATGGACTACAGAATCCTTTTCACGGATGAG
GATCAAGATCGCATGTACGTGGGCTGCAAAGACCACATAC
TCTCGATGGACATCAACAACATCAGCCAGGCCACACTGAA
GATCTTCTGGCCGGCGTCCATCAGTAAGGTCGAGGAGTGT
CAGATGGCTGGCAAAGACCCGACACATGGATGTGGGAATT
TCTTAAGAGTGATCCAGCCTTATAACAGGACTCATCTGTT
CATCTGCGGCAGTGGAGCCTACAGCCCAGTGTGTGCATAT
GTTAACCGTGGCAGACGTCCTGAGGAGCAAGTGTTCCAGA
TCTCTTCGCGAGCAGAATCAGGGAAAGGGCGCTGCTCCTT
CAACCCACAAGTCAACACTGTCTCGGTCATGCTCAATCAG
GAGTTGTTTTCTGGCATGTACATTGACTTCATGGGGACAG
ACGCGGCTATCTTCAGAAGCCTGACCACAAGAAACCCTGT
GCGGACGGACCAACATAACTCCAAATGGCTGAGCGAGCCA
CTGTTCATTGACGCCCAATTGATCCCTGATGGATCAGACC
CCAACGATGCTAAACTGTACTTTTTCCTGCGGGAGCGACT
CACAGACACCAGTGGAAACACGAAAAACATTCATGCCATG
GTGGCTCGAGTGTGCCCTAATGACACTGGTGGTCAACGTA
GTCTGGTGAACAAGTGGACCACATTTCTTAAGGCTCGAAT
GGTGTGTTCAGTTCTAGAGGAGGACGGGACTGAGACACAC
TTTGATGAGCTTGAAAATGTGTTTTTATTGGAGACGGACC
ACCCAAAGGGCCTCCTCATCTTTGGAGTCTTCACCTCCAC
AAGCTCTGTGTTCAGAGGCTCTGCTGTCTGTGTGTACAAC
ATGGCCGACATCCTGACAGTCTTCAACGGGCCGTTTGCAC
ACAGGGAAGGGCCCAACTTCCAGTGGGTGGCTTTCCAGGG
CCGCATCCCATACCCACGACCGGGAACTTGTCCCGGTGGT
GCGTTCACCCCTCACATCCAGAGCACTAAAGAGTTTCCAG
ATGATGTGGTGACGTTTGTGAGGAATCACCCTGTCATGTT
TAACCCCATCTACCCTGTGGGAAGGAAACCCCTGGTGGTG
CGAACGCATGCCGACTACAAATACACCTCTATAGCGGTGG
ATCAGGTCCCAGCAGCAGACGGCCACTACCAGGTCCTGTT
CCTGGGCACAGATAAAGGCACGGTGCAGAAGGTCGTGGTT
TTGCCGTCAAACGGCTCACTGGATGAGGATCTAATCCTGG
AGGAGCTGGAAGTGTTTAAGACACAGTCTCCCATTACCAA
CCTAAGAATCTCCTCTAAAAAGCAACAGCTGTATGTTAGC
TCTGAGCATGGGATCTCCCAGGTGTCTTTACACCGCTGCA
ATGCATACGGCTCTGCCTGTGCGGACTGCTGTTTAGCACG
GGACCCTTACTGCGCCTGGGATGGTCTCAGCTGTTCCCGA
TTCTATCCCACTGGCAAAAGGAGAAGCAGAAGGCAGGATA
TTATGCATGGAAATCCACTGACTCAGTGCAGAGGGTTCAA
TCTGAAAGCCTACAGGAACGCAGTGGAGATGACTCAGTAT
GGAGTCAAAAACAACACCACCTTCCTGGAGTGTCAGCCGA
AATCTCCCCAGGCCTCGGTTAAATGGCTCATTCAGAGAGA
CAACGATCGCAGGAAAGAGGTGAAGCTGAGTGATCGTGTA
GTGTCCACCAATCACGGTTTGCTCATCCGCTCCGTTCATT
CCTCAGACCAGGGTCTCTACTACTGTCTGGCCACAGAGAA
CGGCTTCAAGCGCACACTGGCAAAGATCCGTCTACAGGTG
CTGAGCGAGGCTCTAGTCAGCGCCCTCAGCAATAAACAAC
AGTCTCCCTGGGGCTGGACAGCCAATCTGCACCCCAAAGC
CCTGGTGTCGGCCTTCAGTCCAGCTGAGACGCTCGCCATG
CATCAATACTGCAAAGAACGCAAGCAGATGCAGAGTTTGC
AGAGCATACAGAGCCCCATGAGAGGAGATCTGGGAAAACT
CAAACCCCTGCTGGACCACAGGAAGAGCAGGAACCGCCGA
AATCACTTACAGCAGGACTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sema3c-201 Contained in:
OTHER sema3c-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009531 (1)
  • Ensembl_Trans:ENSDART00000131161 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)