ZFIN ID: ZDB-TSCRIPT-090929-15034
Transcript Name: cbln7-203
Previous Names: cbln7-002, si:dkeyp-55c8.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034134 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034134|OTTDARG00000025832|ZDB-GENE-070912-655 cbln7|OTTDARP00000027543 DKEYP-55C8.3-002 LG_ BX322588.8 Danio rerio protein_coding NOVEL, 898 bp
ACAGGCTGAAGGACTAATTCCAGTGCAGAGTTTGTGTCCT
CTGGTAATTAACAGAGCAAGAAGCCAGCTTGAAGAAGTAG
GATCAGAAAAGCGTCCAAGCAATTTGAAAGCAAATCTTTA
AGATGTCCTGCTGTGTGGTGTATCCGCTGCTGTTTCTCTT
GTTCAGCTGTGTCTGGATGTCTGAGGTCCAGCAGGAAGAG
CACAGAAACAAGACTGAGAGCACTGAGCATTTGGATGTGG
AGGAAAGCGACGCCGCTTTAACTTCTGCTGAGTTTCAGGA
AAACTTTCTTAGAGAGATCTACACTGAACTGAAGACTCTG
AAGGCCAGACAGGAGGTCACTGAAGAGCAGCTGAGGAGAA
CAGTGGCATTTTCAGCCACTCTTGGACCCATAGGTAACCT
TGGACCCTTCAACACTGACATTACTGTGGTTTTCAGAAAG
GTCTTTGTGAATGAGGGAGGAGCTTACAACCCAACAACAG
CGGATGCCCTTCCAGCCACAACACAGCACTGAGAGTGCAA
TCCTCAGTGGTAGGAAACACCCACACACTGTCCTGTTCAC
ACACTAAAGCCAATTTATTTGATCAAGTTGACATATTGTA
CGTATTTGGACTGTGGGGGGAAACTGGAGCAGCTGGAGGA
AACCCAGGCGAACATGGAGGACGTGCAAACTGACAAAAAG
ACCTTGAAGAACCAGTGATCCTCTTGCTCTGTAGCAAATG
TGCCGCCCCCAAATCAGTCAGTCGCAAAATAAAAATATTG
GTAATATTTTATAGAAACGATACATGAATTATCGTGAATT
CATGCAAAAACCGATGCATGGATTATGCATTAATTCATAC
ATTTAGACTTCATGAATTATCAGAAACTTGTTTTTGGTTA
ACCACCCCTTTAAATTTT

cbln7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cbln7-201 (1)    Ensembl 637
cbln7-202 (1)    Ensembl 849
cbln7-203 898
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbln7-203 Contained in:
[BAC] DKEYP-55C8 (1)

Genome Resources: Vega_Trans:OTTDART00000034134 (1),  Ensembl_Trans:ENSDART00000145231 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH500295 (1) 911 nt
CITATIONS (2)