ZFIN ID: ZDB-TSCRIPT-090929-15033
Transcript Name: cbln7-202
Previous Names: cbln7-001, si:dkeyp-55c8.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034133 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034133|OTTDARG00000025832|ZDB-GENE-070912-655 cbln7|OTTDARP00000027542 DKEYP-55C8.3-001 LG_ BX322588.8 Danio rerio protein_coding NOVEL, 849 bp
ACAGGCTGAAGGACTAATTCCAGTGCAGAGTTTGTGTCCT
CTGGTAATTAACAGAGCAAGAAGCCAGCTTGAAGAAGTAG
GATCAGAAAAGCGTCCAAGCAATTTGAAAGCAAATCTTTA
AGATGTCCTGCTGTGTGGTGTATCCGCTGCTGTTTCTCTT
GTTCAGCTGTGTCTGGATGTCTGAGGTCCAGCAGGAAGAG
CACAGAAACAAGACTGAGAGCACTGAGCATTTGGATGTGG
AGGAAAGCGACGCCGCTTTAACTTCTGCTGAGTTTCAGGA
AAACTTTCTTAGAGAGATCTACACTGAACTGAAGACTCTG
AAGGCCAGACAGGAGGTCACTGAAGAGCAGCTGAGGAGAA
CAGTGGCATTTTCAGCCACTCTTGGACCCATAGGTAACCT
TGGACCCTTCAACACTGACATTACTGTGGTTTTCAGAAAG
GTCTTTGTGAATGAGGGAGGAGCTTACAACCCAACAACAG
GTATCTTCACTGCCCCTGTTAAAGGCATCTATTTCTTTAC
AATCGGTGGACTTTATCAGCCATCTAAAGCTATGGTTCTA
GACCTCATGAAAAATGGACAAAAAGTGCTATCCGTTTACA
AGTCTTCTAAAGCTAAGCATTATGATTCAGGATCTAGATC
TGTCTCTTTGAATCTAGAAAAAGGAGATCATGTCTACATT
CAGCTTAGGTCAAAAACATGGATATATGATGATGTAAATG
TCCACAGTACATTCAGCGGCCATTTACTTTTTTCTCCACC
AATTACTAAGGCATATGTTTTACCAGCGGATGCCCTTCCA
GCCACAACACAGCACTGAGAGTGCAATCCTCAGTGGTAGG
AAACACCCA

cbln7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cbln7-201 (1)    Ensembl 637
cbln7-202 849
cbln7-203 (1)    Ensembl 898
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbln7-202 Contained in:
[BAC] DKEYP-55C8 (1)

Genome Resources: Vega_Trans:OTTDART00000034133 (1),  Ensembl_Trans:ENSDART00000141721 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH493571 (1) 882 nt
GenBank:DR722397 (1) 770 nt
GenBank:EB878245 (1) 629 nt
CITATIONS (2)