header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14988
Transcript Name: nyx-201
Previous Name: nyx-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034085 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034085|OTTDARG00000025812|ZDB-GENE-061026-3 nyx|OTTDARP00000027511 nyx-001 LG_ BX545856.10 Danio rerio protein_coding KNOWN, 2226 bp
ATGTGTTTCATCATCAATATTGCCGTGTATTTCCTCCTCC
TCCCTCCTCATGCCCTGTCCCTGTGGGCTTGCACACGCTC
CTGCCCTCCCACTTGCACATGCACTCAGGAGAAGAGTTGC
AGTGTCCTGTGTGATCACGTTAACATGATGGACCTGCCCA
AAGAGTTCCCCTGCGAGGCATCTTCCATCAACCTGGACAA
GAACAGCCTCAAGTTTCTGTCTGAACGGGCATTTGGCACA
CTGCCCTCACTCAAGACACTCTCACTTAAATACAACAACA
TATCCTTCATCACACCGGGAGCATTTAAAGGGCTCCCCAA
CCTGGTTGAGCTCAAGATGGCCCACAATGAGTACATCCGT
TACCTGCACACTCGTACCTTCACAGCACTCAAACGTCTGG
TGCGCCTGGATCTTTCCGATTGTAACCTGTTTAACATGCC
AGATCGCATCTTCCTGGAGCAAATCACCCTCAAGGAGCTC
CTGTGTTTCCAAAACAACTTTAGACGCGTTCCTGGTGCCC
TACGGGGAATGGAAAACCTCACACATGTTTACTTGGAGCG
TAATAAGATCGAAGCAGTGGCTTACAACTCGCTGTTGGGC
CTAACCAGTCTCAAGTACCTCAACTTGCAAGAGAATCGCA
TAAATGTAATACATGATGAGGCCTTCAAAGATCTAATCCG
TCTGGAGAACTTCTACCTAAATGATAATCTCTTGGTTGAC
TTGCCCCAGCAGGCTTTTAAGGGTCTAAGCAACTTGAAAA
TGTTGAATCTTGGTGGCAATCTGTTGACCAATGTCTCCAA
AACATGGTTCAGTGACCTGGTGGAGCTGGAGGTACTGTAC
CTGGATCGAAATCGCCTCTCTTATATAGAGGATGGTTCCT
TTGAGAACTTGACAAGCCTCATCACGCTGCACCTCAACAG
CAACAATCTGACATCTCTGCCTTTCTCCGTCTTCCAGCCC
ATCTATTTCATCGGCCGTCTATATCTTTTTCGAAACCCCT
GGGAGTGTACCTGCGACCTGGAGTGGTTAAGGGAGTGGAT
GGAGAGTTATAAGTTGGTGAGGGACATCCCGTGCGCGTCC
CCATCCTCCGTAGCTGGCTTGGACCTGAGCGAAGTTGTGT
TTGCTCACTTGAACAGCACCTGTCTGGATCCCCCGGAGCT
CAACATGACCACATCTCTTCCTGACTACCCCACCGTGGAG
AACAAGTTCAACAGTCTCATCTCCAAACTGCTACAGCAGG
AACTGAGGGATGAGATGGTCAACATCACAGACAGTCTGAG
GAACGGCACACAGCAGGACCCTGCTGAGAGTCAGGTTTCT
TCTGCACATGGACTGTTCGGTGCTTCTCAGACTGTGTTTC
TACTTGTGGTTCTTTTCCAGGCCCAGTTTGACTCCATTAA
TGCCTCTTGAGATTCTAATGAATACCAAAAGGGGTTGAAG
CGCATCCAAGAGTGGAAGTAATTTTCCAGTAGTTTGGATG
GGAATGGATTTAAGGCTGTGGTGAAACGTTTGATGTGTCT
TGCCATGAGCCCTGTGTTTTCTCATGTTGAAAATGCAATT
CTGGCACATGAAGCTGGAGATGAATGTCTCCTTAAATGAA
TGGAAACTGCTCTCGAAGAGAAGAATGTTAACCAGTTATT
GTCTACAAGACTAATTCTGGACAATAATGAAAGAACTGTT
AAACGCATCTGAAGGCCATTTTGTGAGAACTGAGACTAAT
GGCATGAACGCTTTTATATTCTAGCATTTAATTCTAAACA
CTTTGATAACGCATCTATAGTATGAATATGTTTGTACATG
TTCTGTTGCGTAACTGTGTAACATTTGTTGTGTAGGAGAT
TTATCTGATAAAGCTTCTCAATATCATTTCACCAGATGGC
ACAACACGCTGTCCTCTTTTGTTTGGTTCACTGAGCTGGG
TAAGTTTCCAGTTCTGGAAAATGCATTAGTCCTCCTATTC
CGTAAAGCTTAAGTGCACTCGGTAACGTAAGCTGCTTCAT
ATTGTAACCAAAAAGATTGGCTTCATCATGGTGTTTTACT
GTTATGATCGTGTTTCTTCTCTATGCAGAGCACAATATGC
ACAGGTGGATGATGTCATACTCTGAGCCATGATATATATG
TATATGTAAGTGCATGTACCCATGTGATGTGCATCTATAA
TGGTTTTTGTTTATTTGTGATTGAGCAGTACTTTAAATAA
ACAAAGATTTTTGCATAAATAGTCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nyx-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034085 (1),  Ensembl_Trans:ENSDART00000088569 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ201193 (1) 1410 bp
GenBank:DY555733 (1) 687 bp
GenBank:BI879640 (1) 567 bp
CITATIONS (2)