header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14944
Transcript Name: pou1f1-201
Previous Name: pou1f1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034039 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034039|OTTDARG00000021185|ZDB-GENE-040630-7 pou1f1|OTTDARP00000027481 pou1f1-001 LG_ CR361551.8 Danio rerio protein_coding KNOWN, 1170 bp
GTCACAACGGTGGCCGATGAAGAGTCATGAGCTGCCAGGC
CTTCAGCACCAGCGACTCCTTCAGCGGTTTAGGTGGAGAC
ACTGGTGCTGCTCTCCCCCTGCTGATGCACCACAGCGCCG
CCGCAGACTGCCACAACACCAACATCTGCTCCACAGTCCC
CTCAGGTCTCCCATTGGTCCAGTCGTCCAAGCGCTCTCAT
ATGCACCTGTCCACTTCTGCTTTGGGCAATGCGTCAGCCA
GCCTCCACTACCCGATGCCCCCATGTCACTATAGCAACCA
GCAGACCACCTACGGCATGATGGCAGCACAGGAAATGCTC
TCTGCCAGCATCTCCCAGACCCGCATCCTGCAGACCTGCA
GTGTACCTCATGCAAACATGGTTAATGGCGCCAACTCACT
GCAAGGAGCTCTGGCTCCACGTCTCTACAAGTTCCCTGAG
CACAGTTTGGCTGGAGGATCCTGTGCTTTGAGCCACGGCT
TCGCTCCTCTTCCCCAGACCCTGCTAACAGATGAGCCCAT
TCTAGGAGACATCAAGCAGGAGCTGCGCAGGAAGAGCCGG
ACCCTCGACGAGACCCCCGACATGGACTCGCCTCAGATCC
GAGAGCTGGAGAAGTTCGCTAATGACTTCAAATTAAGGAG
GATCAAACTTGGTTACACTCAAACCAATGTGGGTGAAGCT
CTGGCTGCAGTGCACGGCTCCGAATTCAGCCAAACCACAA
TCTGCCGCTTCGAGAACCTGCAGCTCAGCTTTAAAAACGC
TTGCAAACTCAAATCCATCCTGGCGAAATGGCTGGAGGAG
GCAGAGCAGGCCGGCGCTCTTTTTAATGAGAAGATGGGTC
TGCACGAGCGCAAGCGGAAGCGCAGAACCACCATCAGTCT
GGGGGCGAAGGAAGCGCTGGAGCGGAGCTTTGTGGAGAAG
AGCAAGCCGTCGTCTCAAGAGATCGTGCGAATGGCCGAGG
GTCTGCATCTGGAGAAGGAGGTAGTCCGAGTCTGGTTCTG
CAACCGCCGGCAGAGGGAGAAGAGGGTCAAAACCAGCCTA
CATCACAGCTCCTTCATGACCAAAGACTGCAGAGCCTAAG
AGAGAAAGAGACAGGATTTATTACACAGACACACCAAAGA
GCACATGCACTGTACAAATTGCAGAATTCCACAAATTCAT
TCATGTTGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pou1f1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000034039 (1),  Ensembl_Trans:ENSDART00000081878 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY421970 (1) 1170 bp
CITATIONS (2)