Transcript

gabpa-201

ID
ZDB-TSCRIPT-090929-14927
Name
gabpa-201
Previous Names
  • gabpa-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034019 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034019|OTTDARG00000025771|ZDB-GENE-011010-2 gabpa|OTTDARP00000027469 gabpa-002 LG_ CR759841.8 Danio rerio protein_coding KNOWN, 1914 bp
ATAAGCGTGTCAGTTTTCCCGCTTTCTGCGCGAGCTAGCT
GTTAGCATCCTGAGGGGAAACAGAGCTAGCCGGAGTGCTA
ACAGAAGTGACAATAACCCAGCCCTCTCACGTCCGACGAC
CAGACGTTGGACAAGGAGTTGAAGGGATGTCGAAAAGTGA
GACAGAGGAGATGATTGAAATTGAGATTGATGGACGGGAG
AAACAGGAGTGTTTAGAGGAAGGGATCGAGGAGCAAACCA
TCACAGCAGCTGAACTGATCACTCAGGACATTGACATCAA
TGAGCCGATCGGAAACCTGAAGAAGCTGCTGGAGCCTCGT
CTTCAGATCCCGCTGGATGGATATGACATTTGTCTGCAGG
ACATCCAATTGCATCCTGATCACAGCTTGTTCGATCAAGG
AGTGAAGACAGATGGCACAGTACAGCTCAGTGTGCAGATC
GTCACGAAACCCGGTGAAGAGAAGCTGAATATTCTGGAGA
TTGTGAAGCCAGTGGAAACAGTGGAGGTGGTGATCGATCC
AGATGCTGCTGCTGGCGAGGAAGCTCATCTGGTAGAGGAT
GGACAAGTGATCGCTGTGGAGCGAGCGGCCCTTCCTGATG
AGACCTCAGAGCAGGTGACTCGCTGGGCGGCTGCACTAGA
AGGCTACCGCAAGGAGCAGGTTCGACTGAACATTCCCTAT
GACCCCGTGCAGTGGACAGCAGATCAGGTTATCCACTGGG
CAGTTTGGGTGATGAAAGAGTTTGGCATTGATGAAATGGA
GGTGGGTGGCATTCACATCCCGGGCCGGCAGCTCTGTGGC
TTCAGCCAGGAGGAGTTCCTGCAGAGAGTGCCCAGCGGCG
AGATCCTGTGGAGCCACCTGGAGCTTCTGCGCAAGTATGT
ACTTGCGAGTCAGGATCAAAGTCAGGAAGCTACAGTCACC
ATTGATCAACCGGTGCAGATCATCCCTGCTCCTGTGCAGC
AGGCCACACCTACAGCCATTAAAGTGATGAAGCACAACAA
AACACCACGAGCCCCTCGCATCTCAGGAGAGGAGCGCAGT
TCCCCAGGCAACCGCACAGGTAACAACGGTCAAATTCAGC
TGTGGCAGTTTCTCCTGGAGCTGCTGACGGATAAAGACTC
TCGCGACTGCATCTCCTGGGTGGGCGAAGAAGGCGAGTTC
AAGCTCAATCAGCCGGAGCTGGTGGCTCAGAAATGGGGTC
AGCGCAAGAACAAGCCCACCATGAACTACGAGAAGCTGAG
CAGAGCTCTCAGGTACTACTACGATGGAGACATGATCAGC
AAAGTGCAAGGCAAGCGATTTGTCTACAAGTTTGTGTGTG
ACCTGAGGACTCTGATTGGCTACAGCGCCGCCGAGCTCAA
CAACCTGGTGACGGAGTGCGAACAGAAGAAGCTGGCGCGG
GTGCAGCTGCAGGGCCTCGGTCAGCCTGTAAACACAGTCA
CTCTGGCCACCGCCACAGGTCAACCCGTCACCACAGTTAC
TCTGGCCGCCGCCGCGCTGGACAAAGACAGCTGAGGAGAG
ACTCCCAGCCAATCAGGAGGAAGACAGGAGCAATCCGGGT
TTGATATTTGACTTTGGGCCGGGGTGGGAGAACAGCGGGT
TTGTAAGCAGATGTGCGCTTTGTGTGTGTGGATGAATGAA
TGTGTGTGTGGATGTGAGAAAAGTATAGATGATCACGTAT
GAGCTTTCAGTTTTTTGTATGCTTGTTCTCCGACTGCAGG
GTAGCATCGGCTATATTTCCATTGTATATAACTCTATGTT
TTTGATAGCCACGTGGGCGCAGTGTATTTTGATATTTTCC
ATTTGTAAAGGATCTTTTTCTTTTTTCCTTTTTATTTTCG
AGTGTCCGATTCCCTCAAGGTGAGGTACTTTTTACTGTCC
ACCAGAGGGCAATAAAGAGACAGTTGGTTTTTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations