Transcript

me3-201

ID
ZDB-TSCRIPT-090929-14867
Name
me3-201
Previous Names
  • me3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033956 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033956|OTTDARG00000025738|ZDB-GENE-041111-294 me3|OTTDARP00000027433 CH211-218D20.8-001 LG_ BX294189.11 Danio rerio protein_coding KNOWN, 2829 bp
GGCGGGACTAAAGCGAGAGTGTTGGGAAGCGAAAGCGTCA
ATGTCAAACAGACCTGGATCGTTTGTATCAGTCGATTACA
ACATCATCCGCAGATAAAGCGCCCGTCAGCGGACACAGGC
AGCAGCAAGTCAGCGTTTGGAACAAACTTACTGAAGCAGA
AGCTGCCGGTGGACTGGCCGATCTCAGGAATAATGAACTC
TCTCTCGGGTAAGAGTGTGTTGACGCTATGCAGGGCTTTC
TCCAGTCCTTTATTGCTCCCTCCTGCAATGGTTGGGGCAG
TGAGGGTCTGCCACACAGGTGTGAACTCCAAAGGCACGGT
CTTCACCAGAAAACGAGGCTACGATATCACAAGGAACCCC
CACTTGAACAAAGGCATGGCATTCACCCTGGAGGAGAGGT
TACAACTTGGCATCCATGGCCTGCTGCCTCCCTGTTTTCT
CTCTCAAGATGTCCAAGTGCTTCGTGTCATGAAGAGCTAC
GAGACGCGCAGTAATCCTCTAGACAAATACATATTGCTGA
TGACCCTGCAAGACAGGAACGAGAAGCTTTTTTATCGTGT
GTTGACCTCTGACATTGAAGAATTCATGCCTATTGTCTAC
ACCCCTACTGTGGGCCTGGCCTGCCAACAGTATGGCCTTG
CTTTCAGAAGACCAAGAGGGCTGTTTATTACTATTCATGA
CAAGGGGCATATCGCCACTATGCTGAACTCATGGCCAGAG
GAGGACATTAAGGCCATAGTGGTGACGGATGGAGAAAGAA
TTCTGGGATTAGGAGACCTGGGTGGCTATGGAATGGGGAT
CCCAGTGGGCAAACTGGCTCTGTATACAGCATGTGGAGGA
GTGCCACCTCAGCAGTGCCTGCCTGTGCTGCTAGATGTGG
GCACTGATAATCAGACCCTCTTAGATGACCCCTTGTACAT
CGGCTTAAAGCACAAAAGAGTGAGGGGCAAAGAATACGAT
GACCTCATTGATGAGTTCATGCAAGCAGTCACTGACAAGT
ATGGTATGAATTGTCTAATTCAATTTGAGGATTTTGCCAA
CAGCAATGCCTTTCGTATTCTCAATAAATACCGTAACCGT
TATTGCACCTTTAATGATGATATCCAAGGCACAGCTTCTG
TCGCTGTCGCCGGGATTCTTGCTGCTCTTAAAATCACGAA
GAATAAACTTTCTGATCACAAGTTTGTGTTTCAGGGAGCA
GGAGAGGCTGCTTTAGGAATTGCCCACTTATTGATAATGG
CCATGGCCAAGGAAGGTATACCTCATGCTGAAGCTGCCCA
GAGGATCTGGATGGTGGATTCCAAAGGCCTAATTGTCAAG
GGCAGAAGTCACCTGAACCATGAGAAGGAAGAGTTTGCTC
ATGATCATCCTCACATAAAAACCCTGGAGGAAGTGGTGGA
AACCATCAAGCCCACAGCTATCATCGGTGTGGCTGCTATA
GGTGGTGCTTTCACTGAGAAGATCATCAAGAACATGGCTG
CTAACAACGAACGGCCAATTATTTTTGCCCTCAGCAATCC
CACAAGCAAAGCTGAGTGCACAGCAGAGCAGTGTTACACA
CTTACTGAGGGACGGGGTATATTTGCCAGCGGAAGCCCCT
TTAAAAAGGTCACTTTGGCAGATGGGCGCAGCTTCTATCC
TGGGCAGGGAAACAATGCTTATGTGTTTCCTGGAGTCGCG
TTGGGAGTTATTGCCTGTGGTGTTCGCCACATCTCGGACG
ACATTTTCCTCACTACAGCAGAGGCCATTTCTGAGATGGT
CACTGAGGAGCACTTGGCTGAGGGAAGACTGTATCCTCCA
CTGAAGACCATCAGAGAAGTGTCCTTTAAAATCGCTGTTA
AGATTGTGGATCATGCCTACAAGCAGGGCATTGCCTCATG
GTACCCTGAACCCAAAGATAAAGAGGCCTTCATTTTATCC
CATGTCTACAACTCCGACTACGACTCCTTCACTCTGGATT
CATACAGCTGGCCTAAGGATGCCATGAAGGTTCAGAACGT
GTAGCTTTTTGACCATCATCCTTTTCAAAGGGATATTCTC
ATATCAGTCACATGCCTTATTATTCAGTTCATAACCATCT
GACAGTATACACTCCAGCTCCAGGCCAACCAATCCTTAAA
AAAAAGCAGCTGCTTTCACTGATTTGACACGAGATGAGCT
GTATCTGCTGCGGGTGATAAAAAACAAGCTCAAATTGTCT
TCAGAGCTCAGTTCACTGAGAGAAAAGCAGCTTTTTAATG
CAGTTACAAGCACTTTCCCCCCTCATCTATTCAAGCCCGT
TTGCCAGCAGATCTGTTCAATCTTTTAGCTCTGCTGTCAG
CATTCTATTTATTTCTAACCAGTTATTCGCTCCAACTATT
TAGCACTCCTGCAAACACATATGTACTGTAAGTGTAAGGA
GATGAACTATTTTTGTACAGCAACCCTGAGAAATGATAGA
CTACCTGGTTCGAGCATTTATACGAGAAGGGACTTTTGTT
AGTTAGGTAGGAGAGTAGATATCCAATTGACCTGTTGTTA
ATTGAGTCCTTTTAAAATGGATTTTTTTTACAAGTTTCTC
CTGTTGTCTGCAGCCAAAGTTTGTCTAATTTTAAACATAT
TATTGTAAAGCGCTGAACATTGGTGGCTTGAGTATATCAG
TTTAAATGTCCACCTAAAGTGAGCTGTTTGTCTACGTTCA
TTGGAGTGCGTGCAGTTGTTTTTAATGTTTCTCCTCATTT
AGGATTATGCTTTGCTTCTCAGTAATGCACGATTATGGAG
TTATTTTTTTCAGATATTCAAGGAGATTTTGAAGGGATTG
TGGCTTTTAAATAAACACTTTCAAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations