Transcript

rnf40-203

ID
ZDB-TSCRIPT-090929-148
Name
rnf40-203
Previous Names
  • rnf40-001
  • ottdart00000002280
  • si:rp71-1c10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002280 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002280|OTTDARG00000002117|ZDB-GENE-030131-6607 rnf40|OTTDARP00000002017 RP71-1C10.6-001 LG_none CT030027.5,AL732488.7 Danio rerio protein_coding KNOWN, 3803 bp
TGTCAGTGTTCACAGTTAAACGGTTCTTCCTGTTTTCCGG
TCGGAGCGGAGGGAAGCATGTCTGGTGCAGGGGGTGGGAA
GCGCCCCTCAGGAGGGGACAGCCCTCCTGGCCCTCCTGAA
AAAAAGCTGAAGAAAGAGGAGAAGACTACCACAACGCTCA
TTGAACCCATCCGGATCGGAGGAGTTTCTTCTACGGAGGA
GATGGACATGAAGGTCATTCAGTTCAAAAACAAGAAGCTC
TGCGAACGTCTTGAACAGAGGCAGGCTTTGGAGGATGAGT
TGAGAGAGAAGATTGAGAAGCTGGAAAAAAGGCAGGCCAC
CGATGACACAACTCTGCTTATCGTCAACCGCTGCTGGACT
CAGCTGGAAGAAAACATCCATGAGTTGCTGCAGCATGTGG
AGCCTAAGGATGCCCCAGCACCGGTTCAAATCCCTGCCAC
CCCTCCTGTTCCAGCAGACGCTCCTGTTCCTGCTGTAGCC
CCATCACCTGCTCCTGAACCGTCTGCTCCACTGCCGGCTC
CAGTGGAGGGAGAGGATGGGCTCCCGCAGCCTTCAGTAGC
AGCTGAAGGAACGGAAGATCAGCAACAACCATCACAAGAA
AAGGAGCAGCAGCAAGAGCAGCAACAGCAGCCTGACTCTG
TCGAGAAGTCAGCAGAAGCACCAGTGGCAGATGAAATTCC
AGCCCCTTCGCCTCTTCCACCTCTCAGTGAGAGCGCAAAG
GCTTTTCTGGCCATTCTGGATAACAGCAGTGAAGAGGAGC
TCACACTGCAGCTGCAGGACAGGATGCAGTTCAGCAAGGG
TGCTGTGGCCTGCATGGTCTGCATCTTTGACCGTCTGCAT
ACCAGCATTGACAAGCTGTGCACTCGAGTCGAGTCTGCTG
CATGTGAAGATGACAGTCAGCGAGACATAGCTACCACAAA
CCGCAAACTTCTAGAGGAAAATAATCGTCTGTATGACCTT
GCATCCTCTCTTCAAGGGAAACACCACAAAATGTCATTAG
AGTATAATGAACTGGTTGATAAAGTTACGAGTTCTGAGAC
TAAAGTGTCTGAGATGGAAACTGCGGTGGAGGATCTGCAG
TGGGACATCGAGAAACTCCGTAAGCGAGAGCAGAAGCTGA
ATAAACACCTAGCAGAAGCTCTGGAGCAGCTTAATACTGG
TTACCATGCTACTGGCAGTTCTGGTGGATTACCGGGTGGG
CAAATCACACTCAGCATACAGAAGTTTGAGTCTCTGAATG
CCGAACTGGAGCAGAATCAGGAACTTGCCAACAGCCGCAT
GGCAGAGCTAGAAAAATTGCAGCAAGAGCTACAGGAAGCT
GTTCGGGAGGGCGAGAAACTAAAGATGGATCTGAGGAATA
TCCCAGAGGAAGTGTTGAAGGAGACGCCAGAGTACAAGTG
CCTCCAGTCTCAGTTCTCTCTGCTGTATAATGAGTCTCTG
AGTGTGAAGACGCAGCTGGATGAAGCCAGAGCTCTGCTGC
TTACAGCCAAAAATGCTCATCTACGACAGATTGAGCACAT
GGAGAGCGATGAGTTGTCCCTCCAGAAGAAGTTACGCACT
GAGGTCATTCAGCTAGAGGACACACTAGCCCAGGTCCGCA
AGGAGTATGAAATGTTACGGATTGAATTTGAACAGAATCT
TGCAGCCAATGAGCAAGCAGGCCCAATAAACAGAGAAATG
AGACACTTAATCAGCAGTCTGCAGAACCATAATCATCAGC
TGAAAGGAGATGTGCAGAGATATAAGAGGAAATTACGTGA
AACACAGATGGAAATAAACAAGTTGAAGTGCCAGAGTGGA
GAAGCAACTGCGCTGATACTGGAGGAGAGTGTGGGTGATG
GAGGTCTGGAGGTGAAGAAAGAGGAAGATGATGATCAGGA
GGAGGAGGAAGAGAGGAGGAGAGAGCTGGAAAGACAGCGA
GCACGTGAGCGAGAGCGGGAGGCGGAGAGAGAGAGAGAGC
GAGAGAGAGAGCGGGAGAGACAGCGCAGTGAGGAGCTGAA
GAGGAAGGACTCAGACACTCTCAAGATGCTCAGGGCAGAG
CTCAAAAAAGCTCAGGAGTCTCAGAAGGAAATGAAACTTC
TGCTAGACATGTACAAATCGGCACCAAAGGAGCAGCGAGA
TAAAGTGCAACTCATGGCTGCTGAAAAGAAGTCTAAAGCA
GAGGTGGAAGAGTTGAGGCAGCGAGTACGGGAATTAGAGG
AGAGGGAAAAGAAAGAAAGCAAAAAGCTGGCAGACGAAGA
CGCTCTACGCAAGATTCGTGTGGCCGAAGAGACCATCGAA
CACTTGCAGAAAAAGCTGGCTGCTACTAAACAGGAGGAAG
AGGCTCTGCTGAGCGAGATGGATGTGACTGGACAGGCGTT
TGAAGACATGCAGGAGCAGAACAGCAGGCTCATGCAGCAG
CTGCGAGAAAAAGACGATGCCAACTTTAAACTAATGAGTG
AGAGAATCAAATCCAACCAGATTTACAAGCTTCTGCGGGA
GGAGAAAGAGGAGCTGGCAGACCAAGTGCTCACTTTCAAA
ACCCAGGTGGACGCTCAGCTGCTGGTCGTACAGAAACTGG
AAGAGAAGGAGGGCGTCCTGCAGAGCACGCTGGCCACGCT
GGAGAAAGAGCTGGCGCTGCGCACTCAAGCATTGGAGCTC
AACAAGCGCAAGGCTGTGGAGGCGGCCCAGTTGGCCGAAG
ACCTTAAAGTACAGCTGGAACACACTCAGACCAAGCTGAG
GGAGATCCAGGCCTCGGTACTAGACAACCGCACCGCCCGT
GAGAGGGAGAGTGTCAACCTCAAGAAAGCACAGGAGGACT
TATCCAGACTAAGGCGCAAGCTGGAGAAGCAGAAGAAGGT
TGAGGTGTACACGGATGCTGATGAGATTCTGCAAGAAGAA
ATTAATCAGTATAAGGCTAAATTGCGTTGCCCCTGTTGTA
ATACTCGTGATAAGGAGACGGTCCTCACCAAGTGTTTCCA
CGTCTTCTGCTATGAATGCTTGAAGACTCGCTATGACACT
CGCCAGAGGAAGTGCCCCAAATGCAACGCTGCATTCGGAG
CAAATGACTTCCACCGTATCTACATCACTTAATTCACTCT
GAACCTTTCTGGTGGACTTTTTAACATTAGATGGGAGAAA
AAAAGAAGGGATGGAAGTGGTCTTGAACAGGATTACCATG
GTGTGGTATTTTAAAATGCTCTAAAGGGCCGCTTCCAGTC
TCATCTGTGATAGGTGGTGCTAGTGACCAAACAGACAGTG
ACAGAATGGAAACAGTTGTGAAGTAGTCATGGTCTACAGC
ACGTAAGCCATGCTCCTTCATCGCAGAGGAATCCATTGAG
TTGTGTGTTTTTCTGTTTTTCTTTGCATTTTTAAACTTAT
TGTCGACTCCCCATGAAAAAAAGAGAGGAAAGACTGTATC
TGCTTCTAAATATCATAACTTTACAGAACATGACTGACTG
ATGTTCACACAAATTGTTTTGTTTTGACAATTATGGCCTT
ATCCGTTTAAATCACACAGTAACTCTATCCAGAAACACAG
CCAGTTTCCATGGCGACACTCAATGTTACTGAACCCCTTA
AAGTTTAGCAATGAACAGATGTGATGGTACTGGGTGGAAA
GAATAGACATGCATAAAATTAGAAACATAGATGGTGTTGC
AGTGACTTTTTAAAGGCAAAACAAACATATTCATGCTAAA
GTAAACGTCTCAGCCGATTTAGCTTTAGTCCGGTACAGTA
TATACCCCAACCAGTTCCAGATGTATCCCCAACATGTCAA
ACTACTGCACAGTTTCTTTAAATAATAAAAGCTGATACAG
GTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations