ZFIN ID: ZDB-TSCRIPT-090929-14784
Transcript Name: gpr183a-201
Previous Names: gpr183-001, gpr183a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033852 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033852|OTTDARG00000025688|ZDB-GENE-070615-28 gpr183a|OTTDARP00000027371 CH211-184M13.3-001 LG_ BX470183.5 Danio rerio protein_coding KNOWN, 1448 bp
GCTCAGTCGGGTGTGTTAGAAAACGTGGTTAATGCTAGAC
CAGGAGGTGCCATTTCTGACACTGCCATGATCAGACTTCT
TGACAAAACAACAGCAGAAAACTGGCAAACAAGACACTGT
TGATTTCATAACTGACCCCATGGAGACAACATCAGCAAAC
TTCACCCAGAATGACTCAAATGTCTGTACCAACCTGTATA
ACCATCGTGGTTGGGCACAATATTTCCTGCCTGCAATGTA
TTCCATGATTTGCATCGTTGGATTGCTGGGAAATGTGCTG
GCTCTGCATGTCATTTGGCCAAATTTAAAGAAAATCAACT
CCACGACTCTGTACTCAGCCAACCTGGTAGTGTCGGACAT
CCTGTTTTCGCTTGCTCTTCCCTTACGTGTGGTTTACTAC
GCCAGGGGTTTCGACTGGCCTATGGGGGAGGGTTTATGCA
AGGCTGTGGCACTGCTGTTCTACATCAACATGTACGCTGG
AGTCAACTTCATGACTTGTTTGAGTGTTGACCGCTTCATT
GCAGTGGTACTGCCACTGCGATTCTCCCGCTTTCGGAAGG
TACAAAAGGTACGGTACATCTGTGGGGTCGTTTGGGTCGT
GGTGTTGATGCAGACACTGCCTTTGTTGTCAATGCCCATG
ACAAACATCGAGCAAAGTGGTCACATAACATGCATGGAGT
ATCCCAACTTTGAGAAAATCGACAACTTGCCCGTCATGCT
CATTGGTGCCGTGGTGCTTGGCTTCGGCATCCCTGTGATC
ACTATCCTAGTGTGCTATACTGCACTTTGCCTGAAACTTC
GCCACCTGGCCAAGTCCAATAAACTGACAGAAAAGTCAGG
ACGCAGCAGCAAAGCCATTGGGGTGATCTGTACAGTCATT
CTGGTGTTTGTCGTGTGCTACAGTCCATATCATGTTGATC
TCCTGCAGTATATGATCAAAAAGTTGCGGTATGACCCAGA
CTGCTCAGAGCTGCACAAATTTCAGATCTCTCTTCACATC
ACTGTCTGCTTTATGAATCTCAACTCATGTCTGGACCCCT
TCATCTACTTCTTTGCCTGCAAGGGATACAAGAAGAAGGT
GCTGAAACTGCTAAAGAAGCAAGTCAGTATGTCCTTCTCG
AGCGTGGTCAGGACCTCCCCCGAAGGCTCCTCCAAAGACG
TGTTTGGGAATGACAAAATCCAAATGAACTCCAGAAGCTT
CCAGAAAGAGAGGAGCAGTGTACTTTTGAATAGTTTGGAA
CAATAAACAAGTACAAGAGCTGGACTTGAGTGACTCTTTG
AAATTTAAAGAAAATGCTCATTTCTGACCTCTGCAAAATA
TGTTGTATCAAGCTATTGATTCTAAATATGGTTTAATATT
GTTGTGTAGTTAATTTGTTGAATGACAGAATTGCTTCAAG
TATTTTTATATTGATCTTTTAAATAAAAAGAAAACCAAGT
GACACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpr183a-201 Contained in:
[BAC] CH211-184M13 (1)

Genome Resources: Vega_Trans:OTTDART00000033852 (1),  Ensembl_Trans:ENSDART00000003193 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC142876 (1) 1466 nt
CITATIONS (2)