header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14590
Transcript Name: ankzf1-201
Previous Name: ankzf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033640 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033640|OTTDARG00000025572|ZDB-GENE-050309-80 ankzf1|OTTDARP00000027232 CH211-167J6.2-001 LG_ CR752651.14 Danio rerio protein_coding NOVEL, 2655 bp
ACCGTAGACGTATACGAACACAACCACATGTGTAACTTAA
TATGATTCATTTAAACTTAATCGGACTAAAATCATCTGAT
GGTTCTGGCAAAAAGTGATAGCTTGTTTTGTCTGCTGAGT
CATGTCCTCGTCTCCCGAGCTGCGGAGTGTGTTCACTCTG
TGTGGCGACCAGACGGTGTCTTGTGGGCTGAGGGAAGTGT
CTGCCCTGCTGGACCAGACTGACCCTCCACAGCCTATCCC
ATACACCGAAGATGCTGTACCGAGGAAGACCATGTCTGCT
GGTGAGGTGTCGGACAGGATGTTCTGCCATGCATGTCAGT
GCCCTTTTGAGAGTCGCGAGGAGCAGATGGAGCACTATAA
ACTTGACTGGCACCGCTTCAACCTGAGACAACGGCTGGAA
GGAAGATCAGCGGTCACAGTGGAGGAGTTTGAGAAGAAAA
CTGGCACAGGTGACATCTCAAGTATTTCAGGCTCAGACAG
TTCGGATAGTGAGGATGGCGACCTTGGAGATGAAGTGGCC
CCTGTGCAGACGGACTGTGCTCTGGACACAGATCAGCCTC
AGAGTCGACTTTCTGCCAAAGTTGTCTTCCAAAACGCAGA
GGGCCAGTTCCTGTCACTGTATCGCTGCATTCTGCAAAGC
AAAAAAGACAACGAAGAAGACTTGGTTTCTTCTTTACTGA
AAATCTCCAATAACACTGTTTGGGTTATTCTGATGACTGG
TGGGGGACACTTTGCTGGAGCAGTTTTTAAGGGAAAAGAG
ATTCTGCAGCACAAGACCTTCCACCGGTACACTGTGAGAG
CGAAGCGAGGGACGGCGCAGGGACTGAGGGACTCGCAGAA
CCGCAGCCACACGCCCAAATCTGCAGGTGCAGCTCTTAGG
AGATACAATGAGGCAGCGCTCCACAAGGATATTCATGACC
TTCTGGAAAGCTGGGTTGATTATTTGAAGGAGGCCAGTGC
CATCTTCCTACGAGCACCAAGTTACAACAAGACCATATTT
TTTGGAGGTCGTGGAGCACCGTTGGACAAAAAAGATCAGC
GAATGCGCATACTTCCTTTTGCCACACGTAGAGCCACATT
TAGTGAAGTAAAGCGTGTCTTTGACCTGCTCTCGACCCTA
CATGTTTATCAAAAAGAGACTGAAATCTCCAGTATTCTTA
GTCCATCAAGGAGATTGTGGAAGAAGAAAACTCCTAAACC
TGTTAGTCATCCAGTACCAAACACTAATGTGCCAGCAGAG
GGAGAAGATGCTAAAGAAGAAAGTTCAGGAGAAGATGATT
CAGGAACACTAGAGACTGTGGAGGTGACGCTGGGAACTTT
GGTCCTGAGAGAACACGAGATCTATCCTAATAAGAAGAAA
AGGAGGAAGCGGAAAGAGAAAAGAGAAGACTCAAGCAGTC
GAGAAACAAATGAAGATAAGGCAGATGATGAAAATATGGA
CGAAGGTGAACTGGAAGTTGAAAGTGACTCTAAAGAGATG
CAGAGGAAGTCAAGGGGCAGAAGGAAACCCAAAGGCAAAA
AACCTCAGCCTGAAGAGGATGAAGTGGATGAGTCTTGGGA
GTACAGTTTAAGGGATGCTCTCTACACTGCCTGTAAAACT
GGAGACATCCAGTCATTGCGCAGCCTCCTTCATCTACCGG
AGGACGAAGAGAGCAGAAGAGAGAGAACCACTGAAGAAGA
TCCTGCTTCACAGAGTTCAGATCTTCTCAACAAGCCCATA
GACTCAGCAGGCTTCACTTTACTGCACGTGGCTTCAGCAG
CCGGACAGAAGTCTGTCATCAGACTGCTAATGGATGCAGG
GAGTGATCCGGCCAACAAGACTAAAAAAGGACAGACTCCA
TATGGTGTCGCTCCTGAAAAGGATACAAGAAACGTGTTTA
GAAAATACATGGCTGAACACCCTCATAAATATGACTACAC
AAAAGCACAGGTTCCTGGACCGCTAACCGAAGATATAGAG
TCCAAAAAAGCAGAAAAGAAGAAAGCCCAAAAAGCAGCAC
GCAAGCAAAAAGAGAAAGAGCAAAAAGAAGAGAAAGTAAA
GAAACAGCAAGAAGAGGAGGAAAAGAAGAGGTTCACAGCT
CTCAGTGACAGAGAAAAGCGAGCTTTGGCTGCAGAGAGGA
GATTGGCTGAACATCTGGCCACGACTGGAGGAGCACTAAA
CAACATAAGGAGATGTTTTCTGTGTGGAGAGTCGTTGCTG
GGGAAGATTCCTTTTGAATATCTGGATTACTCTTTCTGCA
CGCCTCGCTGTGTTCAAGCCCACCGTAAAGCCAATGCTGC
AGCGCGGCCCTGACCTCTCATGTCCCCACACACACAGCAG
AGGTACTATTGATCAAACGAAGGTGCATTACTATATTCTG
GACACATTTCACCTCAGTTGACTGTTAGTTTTACTGTTAA
TATATGATGGATTTCTCACAGTTGGCTTGGACAAAGAAGA
GACTATAAAAATGACTTAATGGAGAATTATTAATAAATCA
TGAATGTTGATGAGCACACAATAGGCATATATTAGAGTAA
ACCATGTCAGTGGCTAGTATCTGTTGTTTAGCATGTTTTT
AACTTTTCAGACCAACCACTGTGATTCTATAAATCTAAAT
CTCCATTTACACATGAAATAAGAAAAACAATTAAAAATAA
TGCAGAACTGTAAAA

ankzf1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ankzf1-201 2655
ankzf1-202 (1) 833
ankzf1-203 (1) 491
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankzf1-201 Contained in:
OTHER ankzf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000033640 (1)
  • Ensembl_Trans:ENSDART00000124957 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090778 (1) 1405bp
    GenBank:EE697718 (1) 890bp
    GenBank:EE311577 (1) 837bp
    GenBank:CT717003 (1) 726bp
    GenBank:CK677835 (1) 615bp
    CITATIONS (2)