header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-15012
Transcript Name: ankzf1-203
Previous Name: ankzf1-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034111 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034111|OTTDARG00000025572|ZDB-GENE-050309-80 ankzf1|OTTDARP00000027525 CH211-167J6.2-003 LG_ CR752651.14 Danio rerio protein_coding NOVEL, 491 bp
CAGCACGCAAGCAAAAAGAGAAAGAGCAAAAAGAAGAGAA
AGTAAAGAAACAGCAAGAAGAGGAGGAAAAGAAGAGGTTC
ACAGCTCTCAGTGACAGAGAAAAGCGAGCTTTGGCTGCAG
AGAGGAGATTGGCTGAACATCTGGCCACGACTGGAGGAGC
ACTAAACAACATAAGGAGATGTTTTCTGTGTGGAGAGTCG
TTGCTGGGGAAGATTCCTTTTGAATATCTGGATTACTCTT
TCTGCACGCCTCGCTGTGTTCAAGCCCACCGTAAAGCCAA
TGCTGCAGCGCGGCCCTGACCTCTCATGTCCCCACACACA
CAGCAGAGGAACATGTTTTATAACACAATCTTCAGGAAGT
TTAAGGGGAGGAATGAGTGAATAACCTCCGCAGACCCTGA
AGAATGAGGAATGGTATGTTATGTTGCACAATGATTCACT
GCAGAGGCTGCCAGAAGAGGTTTGCTTCTGAAATGTCCAC
CAAACATTATC

ankzf1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ankzf1-201 (1) 2655
ankzf1-202 (1) 833
ankzf1-203 491
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ankzf1-203 Contained in:
OTHER ankzf1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000034111 (1)
  • Ensembl_Trans:ENSDART00000138398 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL924772 (1) 487bp
    CITATIONS (2)