Transcript

slc26a3.1-202

ID
ZDB-TSCRIPT-090929-1455
Name
slc26a3.1-202
Previous Names
  • slc26a3-001
  • slc26a3.1-001
  • si:dkey-31f5.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009291 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009291|OTTDARG00000008152|ZDB-GENE-041210-180 slc26a3.1|OTTDARP00000008010 DKEY-31F5.2-001 LG_ BX649534.9 Danio rerio protein_coding NOVEL, 1718 bp
ATGCAGCCTTTCGGCAGACACTATGTGGTGGTCAGGCCTC
TGTTTTCAGAGGATTCATTCGCAGAGCAACATGAGAGGAT
CAACAGAAAGCGCAAAACACTACGTCACCATCTCAAAGAC
TATTTCAGTTGTGATGCGAAACGTGCAAAGAATGCAGCTC
TTTCGCTTTTTCCATTCATTGGATGGATGAAGGACTACAA
AATCAAAGAATGGCTACTAGGTGATATTGTTTCAGGCATC
AGCACAGGACTAGTGGCAGTGCTACAAGGACTTGCATTTT
CTTTGCTGGCCTCTTTACCTCCGGGATATGGACTATATAC
TGCATTCTTCCCTGCTATAATCTACTTCTTTTTGGGCACC
TCAAGACACCTGTCAGTGGGGGCTTTTCCAATTCTGAGTC
TAATGGTGGGTGCTGTTGTGACACGACTAGTGCCTGATGA
GGGACCCTCGTTCAACATCACTGGATTTGAAGGGTTGAGC
CTGGAGCAACAGAGAGTTCTAGTTGCTTCCTCTGTTACTT
TTCTCATGGGTGCATTTCAGCTTGTAATGGGGCTGCTGCA
GGTTGGCTTCATAGTCATGTATCTGTCAGAAACTCTGGTG
TCTGGATTCACCACCGCAGCCGCTGTTCACATTTTGGTTT
CCCAGCTCAGGTTTGTGCTGGGCCTGGATTTTCCAGGTAT
AAACGGGCCACTTGCTATCATATATACTTTGGTAGAAGTT
TTTAGCCGAATCACTAGCACAAATGTGGCTGACCTGGTCA
CATCTATTGCAATCATGGCACTGGTGCTTATTGTGAAGGA
GATCAATGACAGATTCAAGTCTAAACTACCTGTGCCGATA
CCTATAGAAGTCATCATGACTGTTATCGCTTGCGGAGTCT
CTTATGCATTCAACTTTGAAGAACGATTTGACGTGGTCAT
TGTTGGGGAGATGGTGAATGGATATGAATCTCCAGTTGCT
CCAAACCTGGAAGTCATTGAGGAGACTGCAGTGGAGGCTT
TCCCTATGGCCATAGTAGGATTTGCTGTGGCTTTCTCAGT
AGCTAAAGTCTACTCTGTCAAACATGACTACACGATTGAC
GGAAACCAGGAGCTCATTGCCTTTGGAGTGAGCAACATGT
TTGGAGCATCTTTCCGCTCATTCGCCGCAAGCACAGCACT
TTCTAGGACAGCCATACAGGAGAGTACAGGAGGAAAGACG
CAGATAGCGGGAATCCTTTCAGCCATGATGGTATTGATTG
TGATCGTCGGAGTAGGATTTCTACTCGAGCCACTACCCAG
GTCTGTTCTGGGCGCTCTGGTCATCGTCAATCTGAAAGGC
ATGCTGATGCAGTTCAGTGAGCTGCCGTTTCTATGGAGGA
ATGACAGGCCGGATTTTGTGACCTGGATGGTGACCTTCAT
GGCGTCTCTGTTTCTGGGTTTGGATCTGGGTTTGGCTGTG
GGTATCGGGGCAGAATTGTTCACTGTGGTCTACAGGACTC
AATTCCCACGTTGTTCTGTCCTGGCCAATATTTCAGGAAC
TGACCTCTATAGGGATCGTAAAGACTACACATCTATTCAG
ATTTACGAACCTGACGGTGTTAAAATATTTAAAATTCCCT
CACCCATCTTCTTTGCTAACATCGATTTCTTTAGAGATAA
ACTGGTTCAGGAAGTAGGTTTTAATCCAATGAGAGTGCTG
AAGAAAAGAAACAAAGCCTTGCGAAAGATCAGAAAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations