Transcript

cradd-201

ID
ZDB-TSCRIPT-090929-1448
Name
cradd-201
Previous Names
  • cradd-001
  • zgc:101717-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009271 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009271|OTTDARG00000008138|ZDB-GENE-041010-168 cradd|OTTDARP00000007994 DKEYP-90A8.3-001 LG_ BX649503.3 Danio rerio protein_coding NOVEL, 603 bp
ATGGACCCAAAACACAAAAAACTGCTCCGAACACAGCGGC
TTTTTCTGTCCGAGGAGCTTTTAGTGGACGATTTAATCAT
TCAGTATTTATATCAAGAGGAGATACTGACGGAGAGCCAT
TTAGAGGAGATTCAGTCTGAGTCGTCAAGCAGAAATAAAA
CGTTAAAGCTGCTGGATATTTTACCGAGCCGCGGAGCGAC
AGCCTTCCATCACTTCATAAAGTCACTGGAGAAAGACTTT
CCCTGGATCAGAGACAAACTGCTGCAACTAAACGAGGAAG
AAGAGTCTCCTCCTCCGCCCTTCACAGTTCAGTGTGGTGT
TCCTGACCACATCCTTCTGACCGTACCAACCACCCTGCAT
CTGAATCAGCTGGCATCCCGTCTGGGCTCAGAGTGGAAGT
CTGTGCTGCTGGATCTGGGCCTGTCCTGTGCGGATCTGTA
CCGGTGCTGCTCTGACCACCCGCTTGCTGTTCAGAGTCAG
GTGCTCGCTGGGCTGGTGATGTGGACGCAGAGGAACGGAA
GAGGGGCCACGGTGCAGCGGCTGATCCAGAGCCTGCAGGC
TGCAGATGTCCCGCCATCTGTGCTCCAACAGGTGTTTAAG
TGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations