ZFIN ID: ZDB-TSCRIPT-090929-14206
Transcript Name: cspp1b-202
Previous Names: cspp1b-002, ottdart00000033072, si:dkey-97a13.9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033072 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033072|OTTDARG00000025134|ZDB-GENE-070912-619 cspp1b|OTTDARP00000026746 DKEY-97A13.9-002 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 681 bp
ACAGGAAAATAGCAAGCGAGGAATAACGGCGCTGCTTATG
TTTTTCCAGAGTGACACCGAACCATGGATCAGTTAAATCA
GATCATGAGGCGATTAGCACTTATTATAAATACACAGTTT
ATTTAAGAAAAACCCGATTAACGTTACTTCAATCGCATGA
ACAAATCCAAACATCAGATGACACGTTCATTCATTTTATC
TAATGAAATCAGGACAGCAGATTTTCTGCTGGCATTATTA
GTTTTCATCAGGTAACACCTATGTTTTAGTGAATAAACGC
AATATCACATTTCACTAACTTTATTATGGTGTCTGATGTC
GGCGTGATCTGATCAAATGGCTGTTTTGTGGAGTGGAGGA
ACAGATGCATTCAGAGTCCTGTAAACAGAGGATTGAACTG
AGTTTCAGCTCTTGGCGGAAATCAAAGAGATGGATGAAGT
GCTGGAGAAGTTTCTGGAAGAGCAGAAGACAAAGATAGCA
GAAGAAAAGGCCTGTCTGGAGCAGGAACCTCCTTACATGG
AGATGAGGAGGCGGACAGGCCATGTTCTGCAGAAAGAGAA
CATCCCTCCACGTACAAGTCAGCAAGAAGGACTAAGTCTG
CCATTAGGAGAGGAATATGAGAGAAAGAAACACAAACTCC
AAGAAGAGCTCAGGAATGATTACAGGAAATACATGACAGA
G

cspp1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cspp1b-201 (1)    Ensembl 2269
cspp1b-202 681
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cspp1b-202 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033072 (1),  Ensembl_Trans:ENSDART00000142792 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH592334 (1) 647 bp
GenBank:EH444794 (1) 627 bp
CITATIONS (2)