header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14205
Transcript Name: cspp1b-201
Previous Names: cspp1b-001, ottdart00000033071, si:dkey-97a13.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033071 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033071|OTTDARG00000025134|ZDB-GENE-070912-619 cspp1b|OTTDARP00000026745 DKEY-97A13.9-001 LG_ BX663525.6 Danio rerio protein_coding NOVEL, 2269 bp
AACATCAGCATCTGTTACGGCTCAAGCCAATGAAAGATCT
GTATCTGTGGCCACACAGGACACTGTTTGCACCACAGGAC
TTCTTATAGGTGCAGCAGATCTGGAGGCCACACTGCAGAT
GAGAAAGGAGCGTTATAGACATGAATTACAGGAACAAATC
GCAGAGAGACAGAGTCGCAGGAGAAGGGAGAAAGAGCTGG
ATCACAGAGTTCAGACAGTTACGGAGGCTGCGAAAAAGCA
GCTGTTTGTGAGGGATGAGTCTGCATACAGAAAGCAAACA
AGGGATGACATCATCCATCGCCTGGACACTGCTGAGCCTG
CTGAGGGTCTTCTGCAATACAGGGCAGATTCTCTTTCTCC
AAGCAGGATGCCTTTTGTCTCTTCTCACCTCCCATTCCTT
GCAGATAAGACTACAAATAATGATGCTGAGAATTTTCTGA
GCGCCAGCAGAGTCTATGGTCCAATAGCAGGAGTTTCTTT
TCCAGCATCAGCAGGAGAGTCACACCTACTCAGTCCTCAC
AACGAGCACAACAGAAGCACTAACAGACAGAGGTTTCTAG
GTGAGAATGAAGGTGTGGGTTCAGGTCATCCAGCGTTTCC
TGCACATCATGAGCAGAAAAGCCGACTCGGCTATAAAGAG
GAGCTCAGAAAGCAGATAGAAGAGCGGGCCGCACAGAGGA
GGGCGGATAGAGAGGAGAAGCGAAGACTGGAGGTGGAACT
CGAAGCCGATATGAGAGCATATGAACCCTGGGGAAGAGGA
GGAGCTGGTGCACCAATCAGAGACAGCACTGGAAATCTGA
TCGCTGACTTGAAGCAGATGCACCTTTTAAATGCAGCAGC
CACAGTACAAAGACCAGAAAGGCCAAGTATGATTGAGACG
CACACGCCACAGTTTGCAAGAGGAAACGTGTTCAATCAGA
TGATCTCACCTCAGCAAGTACTGGAGCAAGACCAATATAA
AGCTTGCCTGAGACAGCAGATGGAAGAGAAGCAGAGGAAG
CAGGCGGAGGAGAGAGAGCGGATGAGAGCAGAGGAGGAGA
GAGAGGACAGAAGACTGGCTGAACAGAGAGAGAAAATCAG
GAGAGAGTATGAAGAGGAGCAGGAGAGCAGGAAACGCAGA
GAAATGGAGCAAAAACTGAAAAATGAAGAGCTTGCTCGCC
TGGCGGAGGAGAGACGGAGAGAGGCAGAGAAAAAGAAAAA
AGAGGAAGAACAGAAAGAAAGAGCAGCTCTCCGAAAACAG
GAAGAGGAAGAGAGACAAATCAGGCAACAGCAGGTTCAGC
GTGCACCATCTCCTCCAATTCCTACATTACAGAATAAACA
GCACAATCATACGGGTTTCTCTTCATTCCGACCTCCTTCA
TCTCCAGAACACAGACGCCAGCAGAGAACAGAGAAGGACA
GAAGTGAGGTTGTGAATGAGCTGTGTGTGTTACGAAGGCG
TCTGCGCAGTGAACAGCGGCGTCTGGAGGAGCAGCTCTTA
CAAACGGAGTGGGAGAATCTTTCTTCACCGTTCACCGACA
GGCACAGGGCATCACAGGATGTGTTTGATATGGCTCGTTT
GCGGATGCCTGTACGAGGCCCCTCCTCCCGTGGCATTGAG
CCAATCAGCTCGAAGGAAACTGATGACATCATGTACAGAG
ACTCCTTTAATCCTCTTTCAAGAACTCAGCAGTCTAGGAA
CAGAGATGTGGAAGGAGGACGAGGATCTGTGCTTCTGTCA
GAGAGTGAATTCATTGATCACAATGGAGTTGCCTTCCCTG
TTCCTCCAGATTTAGAGAGAAAGTCAGCAAAGCTGTCTGC
ACGCGAGAGACGCAGAATAGCACAACTACAGGCTGCAGAA
AGGCAGTCGGTGGAGAAACATCAGCCTATGAACAAACTCA
GAGACTCAAACGTTCTCAGGATGAAGAGACTTCAGGACTT
CAGCCGTCACAACACTGCAGCAGGAGGCTGCTCTGATGAA
GACGACGAGGCTGAAGTTGTTGGTCGCGGTGGGCGTTTTA
TTCTGCCGTCTCCTGGCAGGCCCAGCTCCATCGACACAGC
CACTACAGAGCGCTGGGTTCGAGCAGAGTCATCAGACACA
CTCAGGAGGCTGATGTCTGGATCTGAACTCTGAGGTGGAT
GATGGACAGGCCATAACCAACACAACCCCTCAAACATGCT
TAGAGTGTGTGCTCACGTTTGTACATCCTCTTTATATTTC
TTGAACAAATAAAAGACTGATCGGCGGAATCTCTGTGAGA
TCAACTGCATGATTACATCACTAAATTCA

cspp1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cspp1b-201 2269
cspp1b-202 (1)    Ensembl 681
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cspp1b-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000033071 (1),  Ensembl_Trans:ENSDART00000140188 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO803799 (1) 791 bp
GenBank:BI886973 (1) 717 bp
GenBank:DN903012 (1) 651 bp
GenBank:CK360016 (1) 621 bp
GenBank:AW174885 (1) 547 bp
GenBank:CR930720 (1) 539 bp
GenBank:AL925192 (1) 537 bp
CITATIONS (2)