Transcript

ltb4r2b-201

ID
ZDB-TSCRIPT-090929-14193
Name
ltb4r2b-201
Previous Names
  • ltb4r2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033059 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033059|OTTDARG00000025124|ZDB-GENE-070912-658 ltb4r2b|OTTDARP00000026734 DKEYP-66D1.2-001 LG_ BX511153.10 Danio rerio protein_coding NOVEL, 1780 bp
ATTGTAGTGTATATGGAATCTGATAGCCTGAAATCACAGA
AAAATATAAAGAGCTTAAGCATAAGGTTTGTGAACATCTA
TTCGGGAAACATAAGAAACAAACAGGGAGACCAACTTGGA
GATCACATAACCTAACCAGGTCCATCTGGTCACTTCACAG
GGAACCAGTTCAGTTATTTGGATCTAATCAAGTCTTTAGT
TCTTTCGACCCCTTCCAAATGGCATTGGAAAATGGCAGCT
TCTCCATGGAGAACATAACAACCGCCAGTCCCAAACTCAA
GAGCGTTGTTGATAACAGTACCTCTGCCACCTTTGGGGCC
CTGATCCTCAGCATCGCCATCCTCCTAGGCATTCCTGGCA
ACCTGTTCATCATCTGGAGTATCTTGGCTCGTGCTCGAAA
GCGCTCTGTCACCACCCTGCTTATCCTCAACCTGGCGTTT
GCCGACGGTTGCCTGATGTTCCTTACCATCTTCTTCATAA
TATACCTGGCCAAGCAGAACTGGATCTTTGGAGAAGTCTT
GTGCAAGCTGCTCTTCTACTTGTGCAACACAAACATGTAC
GCGTCTATTATGATCATTACACTGATGAGTTTACACAGAC
TGGTGGCAGTGATGTGGCCCTCATATCTGAGCGTCTGTAC
TCGCAGACTGACCGTTTTATTGGTGCTCGGAGGCCTGTGG
GTCGCCGTCTTTCTTTTGGCAATGCCTGTTTTGATGTTTA
GGGCTGAAAAAACTATTGGGAATAAACGGATAGTGTGTGA
AACTCATCACAATCGTACAGAGCAGGCGGTATTCCAGTAT
ACCCTTGAGACAATGGTGGGCTTCCTGGTGCCGTATGTGA
TCATAGTGAGCAGTTATGTGTGTATCCTCCGCCGCCTCAG
ACAGACCAAGTTCAAGAGGATGATACGAAGCGAGAACCTC
ATTCAAGCCATTATTGTGACGTTCTGCATTTTTTGGCTTC
CTTACCACATCCTTAATGTAGTGCAGGTGATGGCAGCGCT
TACACCAGAGGGAATGCCATTAAAAACACAACTAAAAAAC
ATCTGGGAGTCCAGCCGTGCTGTTACGTCTACTCTGGCAT
TTATCAGTAGTTGTGCCAATCCTGTCCTATATGCATTTGC
TGGACGCTCATACATTAAAGCTGATGGCCTGGCGTTCATG
GCCAGACTTTTTGAGGGAACCGTTCTGGACTACAGTGCTC
GGAAAAACCAACAGACTAGGGATGTCATCAGGCTATAAAA
CTCAAGGAGACACATAGGAATCCATCTTGGACAATAAGTT
ATTCTGGATATTTATATTGGAAAATCTTTTTGTATTGTGA
CTGAACAAATAGAAGGCAGCGTAAAGACATGGTCGTGTTG
AAAATAACACACTTTAATTTATTTACTTTATGATCACTAA
AAAAAACTGTTCAATAGAGTGAGCATAGTGAATGTTTGTA
GTGTGGTATAAATGCAACCCAGAAATACTAGCTTTGCCAT
TTGATCACATGATCAGTGTGGGGTTTCATGATTTTACTGG
TATTTACAAATCATCACCTTTATATGTGCATCAGAAAGAA
GGTGTCCAGCAGGTTGAGGAATATAGTGAATTCAGATGTT
CTTCAGGTAGTTCTGTAAGTTAATACACAGCCCAGACTGA
TTTTTAAAGCAGTAGTCAACATTTGAACTGGATCAAAACA
ACTTAAAAGAATGGGAGTCCTTTAACAGTTAAAAATAACT
TTGATTAGGGTTACACAATATATTGTTTCAGCATCAATAT
TTCAATGTGTGCATCCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations