ZFIN ID: ZDB-TSCRIPT-090929-14192
Transcript Name: ltb4r2b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033058 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033058|OTTDARG00000025124|ZDB-GENE-070912-658 ltb4r2b|no_translation DKEYP-66D1.2-002 LG_ BX511153.10 Danio rerio protein_coding NOVEL, 848 bp
TATACCCTTGAGACAATGGTGGGCTTCCTGGTGCCGTATG
TGATCATAGTGAGCAGTTATGTGTGTATCCTCCGCCGCCT
CAGACAGACCAAGTTCAAGAGGATGATACGAAGCGAGAAC
CTCATTCAAGCCATTATTGTGACGTTCTGCATTTTTTGGC
TTCCTTACCACATCCTTAATGTAGTGCAGGCAAGAATTTG
TCATTCAGATCTTTCTGTGATAATCTATGCAATTACCTAA
ATGTGTGATTTTATTTTGTTACTGTTTTCTGGTCAGGTGA
TGGCAGCGCTTACACCAGAGGGAATGCCATTAAAAACACA
ACTAAAAAACATCTGGGAGTCCAGCCGTGCTGTTACGTCT
ACTCTGGCATTTATCAGTAGTTGTGCCAATCCTGTCCTAT
ATGCATTTGCTGGACGCTCATACATTAAAGCTGATGGCCT
GGCGTTCATGGCCAGACTTTTTGAGGGAACCGTTCTGGAC
TACAGTGCTCGGAAAAACCAACAGACTAGGGATGTCATCA
GGCTATAAAACTCAAGGAGACACATAGGAATCCATCTTGG
ACAATAAGTTATTCTGGATATTTATATTGGAAAATCTTTT
TGTATTGTGACTGAACAAATAGAAGGCAGCGTAAAGACAT
GGTCGTGTTGAAAATAACACACTTTAATTTATTTACTTTA
TGATCACTAAAAAAAACTGTTCAATAGAGTGAGCATAGTG
AATGTTTGTAGTGTGGTATAAATGCAACCCAGAAATACTA
GCTTTGCCATTTGATCACATGATCAGTGTGGGGTTTCATG
ATTTTACTGGTATTTACAAATCATCACCTTTATATGTGCA
TCAGAAAG

ltb4r2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ltb4r2b-201 (1)    Ensembl 1780
ncRNA ltb4r2b-002 848
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ltb4r2b-002 Contained in:
[BAC] DKEYP-66D1 (1)

Genome Resources: Vega_Trans:OTTDART00000033058 (1),  Ensembl_Trans:ENSDART00000156322 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT065602 (1) 831 nt
CITATIONS (2)