Transcript

ltb4r2b-002

ID
ZDB-TSCRIPT-090929-14192
Name
ltb4r2b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033058 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033058|OTTDARG00000025124|ZDB-GENE-070912-658 ltb4r2b|no_translation DKEYP-66D1.2-002 LG_ BX511153.10 Danio rerio protein_coding NOVEL, 848 bp
TATACCCTTGAGACAATGGTGGGCTTCCTGGTGCCGTATG
TGATCATAGTGAGCAGTTATGTGTGTATCCTCCGCCGCCT
CAGACAGACCAAGTTCAAGAGGATGATACGAAGCGAGAAC
CTCATTCAAGCCATTATTGTGACGTTCTGCATTTTTTGGC
TTCCTTACCACATCCTTAATGTAGTGCAGGCAAGAATTTG
TCATTCAGATCTTTCTGTGATAATCTATGCAATTACCTAA
ATGTGTGATTTTATTTTGTTACTGTTTTCTGGTCAGGTGA
TGGCAGCGCTTACACCAGAGGGAATGCCATTAAAAACACA
ACTAAAAAACATCTGGGAGTCCAGCCGTGCTGTTACGTCT
ACTCTGGCATTTATCAGTAGTTGTGCCAATCCTGTCCTAT
ATGCATTTGCTGGACGCTCATACATTAAAGCTGATGGCCT
GGCGTTCATGGCCAGACTTTTTGAGGGAACCGTTCTGGAC
TACAGTGCTCGGAAAAACCAACAGACTAGGGATGTCATCA
GGCTATAAAACTCAAGGAGACACATAGGAATCCATCTTGG
ACAATAAGTTATTCTGGATATTTATATTGGAAAATCTTTT
TGTATTGTGACTGAACAAATAGAAGGCAGCGTAAAGACAT
GGTCGTGTTGAAAATAACACACTTTAATTTATTTACTTTA
TGATCACTAAAAAAAACTGTTCAATAGAGTGAGCATAGTG
AATGTTTGTAGTGTGGTATAAATGCAACCCAGAAATACTA
GCTTTGCCATTTGATCACATGATCAGTGTGGGGTTTCATG
ATTTTACTGGTATTTACAAATCATCACCTTTATATGTGCA
TCAGAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations