Transcript

spsb4a-201

ID
ZDB-TSCRIPT-090929-14181
Name
spsb4a-201
Previous Names
  • spsb4a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000033046 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033046|OTTDARG00000025113|ZDB-GENE-070911-3 spsb4a|OTTDARP00000026726 DKEYP-90G12.2-001 LG_none BX322588.8,BX677675.9 Danio rerio protein_coding NOVEL, 2346 bp
GCAGCTCTCACACTGCCGTCTGTCCTCTCTCTCTCCTCTC
GTCTTCCCTCTTTCTCTCTCTCCTTCTCTTCCTCCCTCTT
CCAGTCCGCCGAGCTGGAGTTGGTAGCCGGAGCCGCGGTA
CAGGACGGAGTACGGAGTGCATAGTGGGACGGAGGCTGCC
ACGGCAGGGATTAACCTCAGGGAGGGGGTGGGGGGGTTAC
ATCTCTGGGGAGAAGCTTCTTTTCTCCTGCATCAGCAGGG
AGACACTGGGAAAAGAGAAAGAACTAGTGTGCGCTCCTCC
TCACAAAGAGAGGTGCTCCCTTCGTGCTTCATCCCACCAG
GTTTACTTATTCCTTCTCAACGACAAGGGGATTCGGCAGG
GGGGACTATCAAAACTGGGTCTGGGGATTCAGTAAGGCTG
GCACTTTCTCTACTGCCAGATACTGACATGTGTTTGGGGG
CTGATGTCTTGATGCTTTGATGAGGTAACGGCGGACTCCG
GAAGCCCAGCCCTTGCGTTGAGCAACCCCTTCCCTCTCCC
CTCCTCCCTACCCCTTTCCAGCCAGCCAAGCCATGGGCCA
GAAAATCTCAGGGAGTATCAAGTCCGTAGATGTGCGAGGG
GAGCCGTCCTTCAGGCCCCTGAGGAGGGAACTGAGAGGGC
CAGATTTCTTCAAGCCAGCCCGACTGGATCTACTCCTGGA
CATGCCTCCTGCTTCATATGAGCAACAGCTTCGGCATGCC
TGGAACTCGGACGACCGCTCCCTTAACATCTTCATTAAGG
ACGATGACAAACTTACCTTCCATCGGCACCCAGTTGCCCA
AAGTACCGATGGCATTCGTGGACGGGTGGGATACACACGA
GGACTCCATGTTTGGAGGATCCATTGGCCTGCTAGGCAAA
GGGGCACGCATGCTGTGGTGGGTGTGGCCACAGGAGATGC
CCCATTGCACTCTGTAGGGTACACCTCTTTAGTGGGCAGC
GATAGTGAGTCCTGGGGCTGGGACCTGGGACGTAACAAGC
TCTACCACAACAGTAAGAACCGGCCGGCCTCTTCTGCACC
CACATATCCAAGCTTCCTGGAGCCAGAGGAGGCTTTTGTG
CTACCAGATACACTGATGGTGGTGCTGGACATGGACGAGG
GCACACTGAGCTTCATGGTGGACGGACAGTACCTTGGAGT
GGCCTTCAGAGGTCTTAAGGGCAAAAAGCTGTACCCCATT
GTCAGTGCGGTATGGGGGCACTGTGAGATCACCATGCGAT
ACATCAACGGCCTAGATCCGGAGCCTCTCCCTCTGATGGA
CCTGTGTCGACGTGCGGCGCGACTGGCTCTGGGACGAGAG
CGTCTACAGGAGATCGAGACATTACCTTTGCCCCAGTCTC
TCAAGAATTACCTCCAGTACCAGTGAGAGCGCAGACTCTC
ATGTAGAGACGCAGAGACAAAGAGAGGAAACCTGAGGTGC
TACTATAGCGCCACCGTCAGGCCGCAGAGGGAAAATGTTT
ACATTGTGGCTCACTGGTGGAATCTTAAGTTCGTTTTTTC
CTTAGTTTGTTTTTTGTTTTCCTCTTTATGAGTTGTTTAA
ATTATTGATGGCTTTGAAAGAAGCTGGAAAGATGCAGAGC
AAAAGCGGCGGCTGCTCAGCAGACCTGCAGCGCCTCCCGG
TGTATGTCTCGCCCCTGGAGAATACGACAGGATAGTGGCA
TTTCAGAAAGCACATTAACCTTGGGATGCCTTTGAAAGCC
CACAGTAGTAATCTTTTCGAAAGACCGTGGCGGTCTCTAG
AGTTAAAAACCATCACATGGGATCCTCAGCGAATGAAACA
AAGCCCTTGAGGGTGCTAGGATTTTCACACAGGACCACCT
AGAGAAGGTAACATGACTGACAGGAGCCATTTTCCCCTTT
TATCTGGGATGGAGTCTATAACCAAGGACACACACATACG
CACGCACGCATACGACCAACAATAAATCACCGAATTCACT
TCTTTTTTTTTTTCTTTGTGAGCTTGAGTCACTTTTCTAT
CTGAGTTTATTGTCAGCGTGAGATTGATTGATGATGATGA
CAATGTTTGGCTATCTTTTTAATTTTATTTATCAGGTTCT
AGATCCTTTTTAATGAACTGAGGATGTGCAAACGAGCACA
TAGATATTGAACACTATCCTACACTCGTCACATATGGCTT
TCGATTTTAAACTGGGATGCTGCTTTTATTATTATTATTA
ATAATATTATTATTATGATTATTATTCTGTCTGAATGCTC
AGATGGAAGTCTGGTTTTTCCAAGGCACACAGTGGAATGT
AAAGATCTTGCTAGCGTTAGCATATTTGAAATGTGAATAA
AAGCCAAGTGAATGAGAAAGCAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations