ZFIN ID: ZDB-TSCRIPT-090929-14180
Transcript Name: clstn2-201
Previous Names: clstn2-001, si:dkeyp-55c8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000033045 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000033045|OTTDARG00000025112|ZDB-GENE-070911-2 clstn2|OTTDARP00000026725 clstn2-001 LG_none CU179756.8,CU693456.8,CT027691.7,BX248328.6,CR936405.6,BX322588.8 Danio rerio protein_coding KNOWN, 9327 bp
GTACATCGTCGCTCAAGGACAGATAAAGCAAGAGAGTTGG
TGTTTTTCTAGATTAACAGAGGAAGAATTAGGTCATCGCT
TTCTGGTCGAAGTGTTGGGCTCAGCATGAAGATGCGCGCG
ATAACAGCGATGCTTCTCCTGGTGCTCTCCGGGCAGTGCG
GCATCCTGGCTGGGAAAGTGAATAAGCACAAACCATGGAT
TGAGACATCCTACCATGGAGTCATTACTGAGAACATGGAC
ACTGTAATGCTGGACCCTCCTCTTGTGGCGCTGGACAAAG
ACGCTCCTGTTCCTTATGCAGGAGAGATCTGTGCGTTTAA
GATCCATGGGCAGGAGGCGCCGTTTGAGGCTGAGGTGTTG
AACAGGACATCAGGTGAAGGCGTGCTGAGGGCCCGGGGCC
CTATAGACTGTGAGCAGCAGAAGGAGTACACCTTCATCAT
CCAAGCCTATGACTGTGGGGCCAGTCCAAATGGAGCTGAC
TGGAAAAAGAGTCACAAGGCGGTGGTTCATATCCAGGTGG
ATGATGTAAACGAGTTCTCCCCAGTGTTCAGAGAGCCGTT
GTATCGCGCCACTGTAACTGAAGGGAAGATCTATGACAGC
ATCCTGCAGGTGGAGGCCTGGGATCAGGACTGCTCTCCAC
AGTACAGCCAGATCTGCAACTATGAGATTGTCACACAGGA
TACACCCTTCGCCATTGATCGAAATGGCAACATAAGAAAC
ACAGAGCGACTGAGCTTCGACAAACAACAGCACTATAAAA
TCATGGTGACGGCCTACGATTGTGGCCAGAAGAGGGCGAT
GGAGAGCGTTCCAGTTCACATTGACGTCAAACCAGTGTGC
AAGCCAGGCTGGCAAGGTTGGAACAAGCGTGTAGATTATG
AACCTGGAACAGGCAGCAAGCAGCTCTTTCCCAAGATGCA
CCTGGAGACCTGCGATGGCCCCTTATCCTCAGTGCGAGCA
ATGGTGGAGCTACAGACCAGCCATATTGGAAAGGGCTGCG
ACAGAGAGACCTATTCCGAGAAGTCTCTGCAGAAGCTTTG
CGGAGCAGCCTCGGGCAGCACAGACCTTCTCCCGGCTCCT
AGCACATCCACCAATTGGACGGCATCCCTGCTGACAGACA
GTGGCCGAGACAGTGACCTCATCTTCCGATTTGATGGACG
ACAGGCAGCCAACATCCCAGATTGGGTTGTGCCACAGAAC
CTGACAGATCAGTTCACCATAGCAACATGGATGAAGCATG
GGCCGAGTCCTGGACTGAGAGCTGAGAAGGAGACGTTGCT
CTGTAATTCAGATAAAACTGAGATGAACAGACATCATTAT
TCTCTGTATGTCCACAACTGCCGTCTGGTGTTTCTTCTGA
GGCGCGACTTCATTCAGCTGGACTCCTTCAGACCGGCCGA
ATTTCACTGGAGACTGGAACAGATCTGTGATAAAGAGTGG
CATTACTACGTCATCAATGTGGAGTTTCCATCAGTAACCC
TCTTCGTAGACGGAGTGACATACGAACCATACCTGGTGAC
AGACGACTGGCCCATCCACCCTTCAGAGATCGATGTACAG
CTGACCGTCGGCGCCTGCTGGCAAGGAGGAGAAGTGACCA
CTCCAAGGTTTACACAGTATTTCCGAGGAAGCCTCTCGGG
GTTGACTATCCGACCAGGGAAAATCGCCACTCAGAAGGTG
ATCTCATGCCTACAGGCTTGCAAGGAAGGTCTCGACATCA
GCTCTCTTGAGAGTTTGGGCAAAGGCATAAAGTTCCACTT
CAACCCGGCTCAGTCGGTGTTGGTCATGGAGGCTGATGAC
TTGGAGAGCATCAACACAGCTATGACAAAAGTTTCCTACA
TCAACTCTCGACAGTTTCCAACTCCCGGGCTGCGCAAACT
TCACATTACCACAACAGTCCAGTGTTTCGGTGAAGACACT
TGCATCTCCATTCCAGAGATCAAGGCGATGGTGATGGTTC
TTCCGCCAAGTGAGCCTCGGATCACCATTGCTGGCGTGGA
GCGTCTGGTTTGGCCATCGGCTCAGCTTCGAGCCCCAGTC
GGAGTGGCTCTTTTCAAGGACATCCACATCATTAGTACCG
TCACCAAGACTGACGCCACCCTCAGCATAGCCCGGAGGCC
TGGTGTCCTGGAGCTGATGCATAACCTGGATTATTGTGAT
GTGCTGGTGATCGGTGAAGAGCTGGACCCGGAGCGGGAGA
GTCTGGAGATCCACCACAGCTCTCTCCTGGGCAAACATCT
GGATGCCACCAACTCTACCTCTGGCATCTCCATCTACGGT
GTGGACTCGATGGCACATTATGAACAGGCCATCAGGCAGG
TGAGGTACCGTAACTGGAAGCCCGGCAGTCTGTCGGAGAG
AAGGTTCCGGCTCAGTTGCTCTGAACTGAATGGACGCTAC
ACAAGCAATGAGTTCAACTTGGAGATTGGAGTAGTTCACA
GCTCAGAGGCCGTTGAGCATGTCAATCACATGGCGGTCCA
ATCCCAGTTCATGAGACCTGTGCATCATCCACTGGTGGTT
CACACTGTCAACTCCGATCACATCTCAGGTACCCCTCCTG
CAGCAACAGTGGTAATTGTAATGTGCATAGCTGCCCTGGT
GGTCATTGTGGTCTTGGGCATCTACCGTATCCACACCACC
CATCAAGACAGCTCAAAAGAGGATGAAGAGGAAAGAAAAG
ACCCGGAGATGGACTGGGACAACTCCAATCTTAATAGCAT
TGAAGGAACTCAGATTGCAGAGGAGGTGAGAGAGGAAGAG
CCAGAGGAAGATGAGGATGAAGACGAAGAAGATGATGATT
TGGCAGGAGATCTCTCTAGCGCTGAATCTGAGGACAGTGA
TGAAGATGAAGAGACTAACATTCAGAAGGGAAAAGTCAAA
GGAAAGCTGGAGTGGGACCCGTCTACGTTACCCTATTAAA
ACACACAAACACAGTCTCACTCTTAACACACACACAAACA
AATTCACACAGATTCACATGCAGACATAGACTTGTGCACA
CATACATGCACATACATAACACACTCACGTTCAATGCCCT
TTCACATTAACAGAAGCCAGAATTTATTGCCTGAAAACTT
GTCGCACATCAACCTGATTTTGACTCCTTCCAACGTCCAC
AAATTCAATCCTGTATCGCCATCTGCTGGTCAATATTGGG
AATCGCACACATCAGTTTAAATGTTGCAAAGTCTGTATGA
GGGTCAAAGACAGGGGTTTTAAGCATCAAAACATACACAT
TTATAATACATTTGTTTGAGTACATTAATATTTTTATTAT
TTATTTTATTTTTTTCTGTGCAAAATTACTCTCATACCTA
ATTATTTTATTAGACATCTGTTAAAATTTGATTCGGTATA
ACAATGGTTTATATGCCAAAAATTATTGTCAGACACATTT
AAAATGATTTAATTCTGTTTAACAGTCTATTACAGTAACC
GAGAGAGTTGAACGTGCTGTAATTTTCGAAGACACATCAA
CAAATTAGGAAAAGATCTTCATGGGTTTGACAGCATTCGT
GCTGCAAATAGTCACAATGCAAACACACTTTTAAAAAAAC
TTGCTGCCTTTTTACACAACATAAACAAATGAATAAAACG
CACTGCATTTTCTCACAACACAAACATTTTACGAAAACGC
ACTGCATTTTCTCACAGCACAACGGAAATGTTTCAAGGAG
ACCCTAAAACGTGACGGGCCTGGCTATTTAGGTTATGGTT
ATTTAGACTGATAAATAATAAAGACACTAAAGATAGTAAA
CTCATCTTTTAAAGATTACCTACAACTTCACTGAGCAGTA
TGTAGTGTCCCAGTTCGCATATTTATACTACGCCCTTAAA
GTGTTTACTTTTTTGTGAAGGAAATATATACTTTTGAGTG
TGTGACAGAAGAGTATGCAAGCTTTGGGACATCCTCATTA
ACAGATCGTTAACAGATGTTGCTTAGTTATGAGCCTTGTC
AATCATTGTTTCTGTCATATTTAATATCTTACCATATTGG
AGTAGCAGTAGCAGAATAATCTGCCATTCACGAGTCTTTA
ATGCAGAGAAATCTCCTCAGGTCTTTGGATAGTTATGTTT
TCAGACATTAATGTCCAAAAAATGTTTATATATGTTCAGA
ATTGTTGTTGCAGATGAAATATAACCCAGAAAACACGATT
TAAATATTTTTCAGTCATACAAACATCTTTAATGAAGCCT
TTCTACTTGACGGTTGTTCTCGCGCGTCTGCCATGTTTGT
AGTTTTCACCTACATTTGTAGTTCTAATCAATTTCACGTC
CAACATGCAATGTACTCTGAGCAATTTTAGCGATTAGAGT
ATGGACGCTTCTACACTTACCAATTTCATCGAAAATAGTG
AACCATTCAGGAACCTTTGGCATACTCTTCTTTTGGACAT
ACTAATTCTATTTTCAAATGATATTTAGGACGGATAAGTA
GTGGTGGGCAAAGCGAGGTTTCTTTAAACACTGGAACAGT
CGAAGCAAATGTGTCAAAGCTTGGAAACATTTCGAAACTC
ATCTCTACACTCACACCTAGTGTTCAGAGCAGTGAGAGTT
CTAGACTAGCATGTCGCGATAAGGGGTTCGAATCCAGGGT
GATGCAGCTACATAGAAATCATAAAAATTTACATTATTAA
ATACATAAAGTCATTATTTCAGAGTATTTGCACAAGTCGG
GATTTGAACTCCGCACTTTTGAAGCACAGCACTCTAGGTC
CACTAGGCTAAAGGAGATAAAGTTTTTTGAAAAGCTTCTG
AAATGAACAATGCTTTGAATCGCTTTAGACACGTGACGTG
GGTGTTTCGAATCACCTTAGTCACGTGACCTGGGTGCTTC
AAATTACCTTAGTCACATGACCTGGGTGTTTCGGATCATG
CTTCGGTGCTTTGGTTTCAAAACACTTGCACTTTGGGATC
TCGACGCTGTGTCGAAACATCAGTTTCATGTCAGCCGCCC
CTACGGATAAGTATGCGAATTGGGACTTTATACAGCACAA
TGATGTGCCTCACGTTTTTGGTTCCCCTTGAAACAAATCC
ATTGTGTTCAGATGTTTTTGTATTGTGAGAAAATGCAGCA
TATTTTCATAAAATGTTTGTGTTGTGAGAAAATGCAGTGC
GTTTTATTAATTTGTTTGCGTTGTGTGAAAATGCAGTGCA
TTTTTTTTTATGTGTTTGCGTTGTGATGGTTTGCAGCACA
TGTGCTGTCAAACTGATGAAGATCTTTTCTCAATTTGCTG
CCGTTTTTTGTAATTGCACACGTTTCTTGAATTGTTAAGT
TAAGCTTAAATTGTTAAGTTAAGCTCTCTTGGCCACCGTA
TCATATTGTATTTTCAAATTTTTCTAGTTTGACATTGTTT
ATAGCAAATTTTATTCAGTTTTTATATCCATTTTTAAAAT
CAAAAAGAATTTGAACATATTATGATCACTTATACGTTTA
TATATTTTAATAAGCACAGGTCTGAATATCTGTTTGTTAC
ACTGAATATTTCATTTTTTACCTGTATTTAGATTTTTGTA
TTATTTTTTAAGCATTACAATAGACACTTGAATTCAACTT
AATATGCTTTCTTCTATATAAAATCAGTTACTCCTCGTCT
TTGACCCATGTACTTCTGAAGGATAAATTGCTGTGTCTCA
CAAAAATGAAAGATGAGTCCAACTCGACACTACAGAAAAA
AAGAAAAATCTGAATCAACATCTCTGGGATGCTTTTGTTT
CACGTTTACTGTTCTTTTGTGCGTTTTGCGTTGATTAATC
CGATTATAGTCTAACATCACAATTGCTTTCTCCCTTTCTG
AAATACTAAACCGTAATGTTTGACAGTGTGGCTACGCCTT
CACCATTTGTTGTCTTCAGAGTTACATTTAATATTGCATT
GATATGCAATAGTAAATACCCAAAAGTTGTTTTTGCAATG
AAAGTATATAATAATAATAATGATATTTTCTTCATTTTGA
AAACTAGCAAATAGTTTATTTTAGCTCCTCGGAGAGATTT
TGATTGAGTTGATCCTCTTTAAACAAAAGATATATAGTAA
TGAAATATGACTTTTAAAAACTATCTTTCTTTCTTTCTTT
TGGGGTTTTCGGTGGTAAGATAGGAGGAAGTGTCTCTATA
CATTTTTATATGCCTGTCTACTGTAAATAGGGAACTGTAG
AGTAGTTGAATGGTGACTCAGACTCCTCACGTCCTCCTGC
ATCCTTCACACAGCCTGTTCGTGTCCACACTTGCTTGCCG
AAGAGGAAGGTTCTCCTCCTCCTCCTCTTTCTCTGTCTGT
GTTGATCTCTCTTTTTATGGTTCATGTCGTCCTCCTCACC
CTAACAGCGGATGCTTCTACCGCTCTCCACCTAATAGATT
TGTCTGAGCCTCTGTAGACGAGGGCACTTTTAAACTATTA
AACAGAACGAAAACTGTTCGACGATTTTAGCCTGGAGCTA
TTTTGGTATTGTGAAGGTCTTTACTAACTTCCTTTCAGTG
TACAGTTCAATTAAATATAACAGGAACGGATAGAAAACAA
AGCAGGATAAGTGTGAAAACTGAGGCTTGCTTTGAGAGCG
TCACAAATGTGTTTTGTTTTCCTGTAGCGGAGAGGTTTTA
AGCGATAGTTCACCCAAAACAATGAAAATGTATTTATTGT
CAATTAGTTTACTCTCAAATGGTTCCAAGAAAAGTGTTCA
CATACAAAAACCTTTAAATGCTGTTTGATATTTCCTTCTA
AAATTAGCATTTTCTCAGACTATTTTGTGTTGGCTCAGTA
ATTTTACTTTTATAGTGACAAATGTTGTTTCAATTGCCTT
AAAAGTGAATTAACTGAACATAAACATAGGAGACAAAAAA
TATCATTTTAGGAGAAAATTTCAGACGACATTAAGAGGTT
TTTGCATCTGAACTCTTCATATGTTTTCATTCATAGTAGG
AAACAATACTATGAAAGTGACTAATGTTTCCATCCACTTA
TTTTATGTGCGGACAATATATGAATATTGCATTAAAAAAT
GCTTATAGGTGACCCAGCCTGATCTCACGAGAAAACGCAA
GTATTTTAGGTTTTGTCAAATTAGTGGCTAATTCGTACAA
ATTCAAAAGTCGTACGAAAATGTACAATTTTAAAAAAGGG
GCATGGCGCCAAACCCCACCCCTTAACCCCACCTTCATTG
GTTTATGAGCAAATTGTACCAAATAAAGCAAATTAGATCG
TACAAATTTATACGAATTAGCAACTGAATCAAAAAAGTTA
CAAATTGCCGTGAGATTGCATTGGGTGACCTATTATGCAA
TTTTTTTTTTTTTTTTTTTTTTTACAAAATGTAAGCAGGT
GTGAATTTCAGCTCAAAATACACAACAAATAATGTTTTAT
AACTCTCTGAAACTGCCTATTTTAGGCTTTGATCCAAATT
GTGGGTCATTTTAAATTCAAATGAATTTGAAATGCAAATT
TTAATTTAAAATGAATTGTGCTTTTTTTCAAAAGAGGGCA
GGGCTACGAATACTAACGTTATCTGAATGAAAAACTAGAG
TGATTACTTGTGCATCCCAAAATCCCAAATTTAAACTCCT
CTTAATTGCTGACATTTTCTTAAGATGGTCAACTTTATTG
GCGGACATCTGCTTCTCACTCAGGGCTGTTTATGCTAATG
AGGGAGATATCGTCAATAATGGGAAGGGCTTTCGTCTCTG
ATGGCACGTACAGCGGTAGAATATCAATCAAAGTGTTTCT
GCAGACTGATTATATCAAGTGTGATTATAAAAAATTTAAT
GAATTAATTTGCAGCATTAAAGGCTGCCTATATTCACACA
CTGTTGCTGTGCAACTGTGTTTATATCCCATATAAAAGTA
ATTTTTGCATAATAGGTCCCCTTTAATAGAAATGCCATGA
TGTGCAAAAAAAGTGCATAAAAACATATGCACACAACTGA
GTATAGGATAAACCTTTTATCCAATAAGAAAGAAATGTGC
ATAAACACTAAATTGTATTTATTTAATTTAATTTTTTTTT
TTTTCATTTTTTTTTTATAGGCTGTAGCGGATTCTCCTAC
CACAGCAAATTCCATTTTTCTTTTAATACTGGGCACCAGT
TTATCAAGAACTGACAATTTTGTCCTCTTTGACTCATTGG
ATGGAAATAATGCATGAAACATTTTGAGAATAAAGCACTA
TTTCAGTTTTGTGAAGAAGTTTAATTTACATATTTCTCTC
ATTTTTGCTGCTTGTTCAAACTACTTATTTAAAATGAGCT
GAATTACCACCCGCTTCAAATGCTATTACTTGATTGAATG
TGCATTATCATTGGTTATCAGCTGATAGATACAGTATGGG
CCAGTAGAAGGCTGTTATCATTCATCCACATGGTTAATCA
GCTATATTATTAGAGAATACTTCAGATCCAGATCTGTACT
TACATTACTGTGACGATTGGGGTTAGGGTAGAGGTAAGAT
GTTAATAAAATACAACAACTGGAAAATTTATTAAACGGTA
TTTCTCGTTATAGCCGCAGCCATATGTGATCTATAGCTGA
TTAACCATGTGAATGGGTGATAACAGTCTTCTGAGCCTAC
CAGTAGACGCAGAAGGCCCCTATACTGGCCCATTTGTCTC
AGCTAAAACACCCATTCAATCGAGTAATAACATTTAAATC
GGCTGAATCAAAACAAAATTCAAGTTTGTTTTGAGACATG
CTTATTCATTTTATGTTCAATACATACATATTAATCAATT
AGTCTTGAGAAAAATCATGAAGGAATTTTGTGGAACCCTC
AATTTTTTTGACAGTGTTGGATGGAAACATGAGTTTCAAG
ATTTATTTATAGTATATTTTGTGTTCAACAGAAGAAACTT
ATCCCAATCTAAGGTTTGCAAACAAATGAAGGGTGAGTAA
ATGATGATAGAATTTTCATTTTGGGGTGAACTGTCACTTT
AAGTAATATAAGAGCAGTTCTAGTTTTTTTTTTTTATCCC
CCCGAACACGTGCATTTATGACTATGTGCATTGGGTTTCA
TGTAATGTCTGTTGCAGTGGTTAGGATTTCTCATCCCATT
AGCCAAACCGTGCTTGTAATGTCAGCTTTGTGAGACATCC
CGTTCCCCCTCTGTCCACCTTCCAGACCTATATTTCGCTA
GTCCTTTTTACCATGTGTGTTATAGAACAAGAACAAAAAA
AAAAAAGAAACTTTTAAAAAGATCAACCCTGTAAAATCAT
GTAAGACTATTCTTTTGTATATGTTTCTCTCCTTTTGTTT
TGTAAAGAGTTTTTTTGTTTATCTTCTTTGATGGTCACTG
CAGCACTTTCTGTACATTGACCAATAAAGACTTTCCTTAG
AATGAGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clstn2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000033045 (1),  Ensembl_Trans:ENSDART00000085675 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL919898 (1) 466 nt
GenBank:AM422117 (1) 464 nt
CITATIONS (3)