ZFIN ID: ZDB-TSCRIPT-090929-14143
Transcript Name: cbx3b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032978 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032978|OTTDARG00000025075|ZDB-GENE-070628-2 cbx3b|no_translation cbx3b-003 LG_ BX571678.14 Danio rerio protein_coding KNOWN, 466 bp
AGTTACAGTAGTGTAGAGTTTTATTACTCCAGAGCCTGTC
CAAAAGCTGCAGGTTTATTACTCTTGCCATGTGATTTATA
ATTCATCTCTCTTCTCAAGTTTTCTGAAGTTCATTTCTCT
GTGTGGAATCATGCAGGCTCACCAGCAGCCTCAGGAGGAG
CTCATTGAAAGGACTAATGAGGAGGTTGAAGAACACAACG
CTGAGATCCCAGTAGGCCAACCCGGCCACCCTGAGCCAGA
CTGCATCATCGGCTGCACAGACCAGCAAGGAGAGCTCATG
TTTCTTATCAAGTGGAAAAACACGGATGAGGTAGCTTTAC
TAGCAGCCGTGGAGGCCAGTAAAAGGTGGCCCCAGATGGT
AATCCGCTTTTACGAGGACAAGCTGACCTGGCATGGAGAC
GACGAGCAGTGAAAGAGAAAATATGTAGCAGTGGATACTA
CTGTACCTCCTGGCAGCTTTAAACAC

cbx3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cbx3b-201 (1)    Ensembl 2678
cbx3b-202 (1)    Ensembl 757
ncRNA cbx3b-003 466
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbx3b-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000032978 (1),  Ensembl_Trans:ENSDART00000139737 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH446444 (1) 495 nt
GenBank:EH472300 (1) 475 nt
CITATIONS (2)