ZFIN ID: ZDB-TSCRIPT-090929-14142
Transcript Name: cbx3b-202
Previous Name: cbx3b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032977|OTTDARG00000025075|ZDB-GENE-070628-2 cbx3b|OTTDARP00000026671 cbx3b-002 LG_ BX571678.14 Danio rerio protein_coding KNOWN, 757 bp
AGCTACGTATTGTTGGCAGTGTTTATGAGAGGAATTCCTG
GAAACCATGAGGAAAAAACAGAATGTAAAAAACAGGAAAG
CAGAAGAGACGACAGTTGTTCAGGAGTTTGCAGTGGAAAA
AATAATTCGCAGAAGAGTCAACAACGGAAAGGTTGAATAT
TATCTGAAGTGGAAAGGATTTACAGATGCAGAGAATACCT
GGGAGCCAGAGGATAACCTGGATTGTCCTGAGCTGATAGA
AGAGTATCTCAGAAACCTAACTGTATTGGGACAGGAAACG
GAACAAGAGGAGTGTCAATCTCTAGATCACGAAGTTCAGC
CTAAGGAAGAGTTATCAGAGTTGGCTGCTGATATGGCTCA
CCAGCAGCCTCAGGAGGAGCTCATTGAAAGGACTAATGAG
GAGGTTGAAGAACACAACGCTGAGATCCCAGTAGGCCAAC
CCGGCCACCCTGAGCCAGACTGCATCATCGGCTGCACAGA
CCAGCAAGGAGAGCTCATGTTTCTTATCAAGTGGAAAAAC
ACGGATGAGGTAGCTTTACTAGCAGCCGTGGAGGCCAGTA
AAAGGTGGCCCCAGATGGTAATCCGCTTTTACGAGGACAA
GCTGACCTGGCATGGAGACGACGAGCAGTGAAAGAGAAAA
TATGTAGCAGTGGATACTACTGTACCTCCTGGCAGCTTTA
AACACACAAACACTGTGGCTTAAGTTTACTGTCCGTTTAC
TGTACCGTGTAATAAAGTGTGCAAAGCCACACTCTAA

cbx3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cbx3b-201 (1)    Ensembl 2678
cbx3b-202 757
ncRNA cbx3b-003 (1)    Ensembl 466
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cbx3b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000032977 (1),  Ensembl_Trans:ENSDART00000136235 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH550870 (1) 807 nt
CITATIONS (2)