header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14027
Transcript Name: pappa2-201
Previous Names: pappa2-001, si:dkey-39f8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032695 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032695|OTTDARG00000024927|ZDB-GENE-070912-525 pappa2|OTTDARP00000026454 pappa2-001 LG_none BX649439.8,CR388403.8 Danio rerio protein_coding NOVEL, 6727 bp
AGCAGCTACATGTCAGTGGCACTGGGGGAGAAAGTAAGAG
TAGATGGGAGCAGGCAAGGGCTGGGTTGGACCTGGGTAAG
TTTTCTTTTCTAATGGCTGGGATAGGGGCTGGGTTTGTGA
TGTCAGGCTGGAGGAAACAGATAAAACGTTTAGCGCGTTA
GTTTGATCTGATGTGGAGATGTGGAGAGCGCGTGCAGCGG
GACTCAGCTTGGGAATATAGACACACTGACGGAGCGCAAG
AGGAGTCTCCGCACCATCTCAAGGTGATCCAGAGAGCCGT
TTTGACTTGGAACAGCATGCCAAAAAGACAAATCTCCTTT
CAGTAACCTCACATTCTTGGATACTGATCAATATTTAAAT
AACAACAAGAGTAATGATGATGATAATAAAATCTTTTTAA
GTGGACTTTCACAGCTCCCCGATATCTGAAACACTCCACT
GTTAGTATAAACCACGACAGGCTTTTGACGTTTTGGCGGT
TTGTTTGCAGGACGAAGCGTGACCGCGAGCATTTGGACGC
GACCCATTGCGCGCCGGTGAAAAGGTGGCAACCTCAAATA
ACCTTTATCCAGCGTTACATCTCTACAAACAACCTTACAC
TGTACAGACAGCAAGCTATGTAAGTCTGCAACAAAACGCG
ATATTATCGCTTTCATTCAACCGCAGTAGGGATAGCTTAT
TGCGCGCGTAATTAACTATTAGTGAATGACAATTAGTCAT
TTGCGCAGGCAGTGCGCGCTCCAGAGGCAGCTTTTTCAGG
AGATCCAAGAGTCACGGGATGTTCTGTTTGGATCATAACA
CTCAAAAGGAAAGAAGAAAAGACTTAAAGTAAATAGTTTG
ATGTCAGTTACTCACTGTTAGGTTGCAATTAGCAAGGGAA
CGAACAATCCACCTTAATCAAAGTTCTTTAACAAACACAA
CTAATGAAGAAAAGGCTATTTAAACGAATTAACTGTTAGT
CCCTTAGCAAGTGCATTTCAAAACAAACAAATGTCCACGC
ATTGAAGGCTGCAGCTTCTCCTCAATAAAATGATGTTTTT
TAGACTACTGGCTATTATTCTTGCAGTATTTCACACGTGG
CCGCTGAACAGCGCTCAGTCAGACCATATCCAGAAGTATA
AGCGGACACTGGCACAGAGAGCGGAGCGAGCGCTGGCTGG
AGAGCAGTGCGGATCTGTCAGCCGCAAGCGGCCACCGCGC
TCCACGGCGCACCATTACCCTCTAGCGGGGGTGAGTGGAA
GATACACCCGCTTGACAGACTTGCACTTGAGGAAAACTCA
CACTGTGAGGTCGTGTGCAGGTGACTGCAGCTCTAGTGCG
GTTGAGTTAACCAACTGGGATGCTAATGAGAAGGAAACAT
TTGTTCAACCGCAGGAAGAGACTTTCATATGGAAGAAAGA
AGGCAAACGGGCACAGTGGGTCACTGATCCTGCCTCGGCT
AAGTCACTAAATCCCTCTAAACGCATATCAAAGGGACTCC
CTTTGCAGACCGAACAGGGTGCTGATTTCATAGACAGCTT
ATCTAAAACTAGAAGGGTTGCACGGAGCATTTCAGAGTTC
AACAATGAAGAAGTCATCCCAGAAAAATCCTATAACCACC
ACACAGAATATTCCACAGAAAACGAGGAGTACTCTGGGGA
GCAAGAGGGGCTGCAGAGCACTGCTGGGGAGCTGTGGAAG
GCCGAAGTTCGGGATGTGCCCACAAAGTGGATGACAGGCA
TTTACTTCAGCGGCCAGGCGGAGCAATTAAAGGTGAACCC
TGCGTTCGCCATAGAGCTTCCCCGTTCCAGATTTACCATA
GAGCTGTGGGTCAAGCCAGAGGGGGGCCAGAATAACCCTT
CCATCATCGCAGGTGTGTTTGACAACTGTTCGCATCCCTT
GAGTGAAAAAGGCTGGTCTGTCGGGATTCAAGCAGCAGAC
CCTACAGGAAGAAAGGATGGCAGGTTTTTCTTCTCCCTTC
GCACTGATCGTTCACTTAAATCCACCACTATCATCGGACA
TCAGCGCTACCAGCCTGACAGCTGGACGCATGTGGTTGCC
AGTTATGATGGCCACAAGATGGCGCTGTATGTAGACAATT
TCAAAGCTGGCGAGAGCAGTGAACAGTCGGGTGACCTATA
CAGTTCCTATATCAAGGCTTGTCGGTTGTTTCTGCTTGGC
GGAGACCAGTCGGATCACGAGCACAGTTTTCGTGGACATT
TGGGAGGCGTTGCGCTCTGGGGTTATGCACGTTCTCATGA
AGAACTTCTTAAAAGCCACCAACCCCATTCAGAGAGGCAA
TCTCCGCTCTTGTCCCAATGGGCAGATTTCTCAGAAGTTG
AGAACCAGTGGGTGCCCTATAAAGATCGTCACAACCCAGT
AATCGTGGCTCTTCCTGTCCCAGAGCTACAGCTTGTGTCT
CCGTTTCTGCCACCTCCATGTGGGGTGACTGTGTGCGACA
ATTTCGATATCGCCCTTAGTTATAACAAGCACTGGCAAAT
GCGAGCTGAAAAGAAGATTCGTTACCGCGTTGTGAACATC
TGTAAAGACAACGGCAGTGACCCTTCAGTCTCCCTGCAGC
AGATCCAGCGTCAACACCAGGCTTTGGAAGATGCCTTCCA
TCCCTACAACATCACCTTAGAGCTCAGCATACACACAGTC
TACAACTCTTCGCTCCAGCGGCGCTTCATCCTCAGCAACT
GCCATATTGCCAAGGTTGGCAATCGCCACTGCGATCCAGA
GTGTGACCATCCTCTTACAGGTCATGATGGAGGAGACTGC
TTGCGCATGGGGCCCTGCTACAACTGGAAGCGGCGGGATG
GAGTCTGCAACCCAGAATGCAACAGCATTCACTATGATTA
CGATGATGGTGATTGCTGTGACCCTGAGGTTACAGATGTC
GCAAAGACCTGCTTTGATCCAGAGTCTCCTCAGAGAGCTT
ATTTGAGTGTGAAGGAACTGAAAGAGCTGCTTCATCTGAG
CAGTTCAGACATGCTCAACGTGTTCTTCGCTAATAATTCG
GCACGTGAGGAGCTGGCTGGAGTTGCCACTTGGCCATGGG
CAAAAGAAGCTCTTACTCACCAAGGTGGAATGATTCTTAA
TCCTGCCTACTTTGGCACCAAAGGGCACAACAACACCATG
ATCCATGAGATGGGTCATATTTTTGGACTGTACCATGTGT
TTAAGGGTGTGAGCGAACGCGAATCATGTGATGACCCCTG
TCAAGAGACCACCGCATCGATGGAGACAGGAGATCTTTGT
GCGGATACAGCACCAACCCCAAAGTCTAAAGCATGTCATG
ACCCTGATCCAGTCAACGACACATGTGGCCTTACCCAATA
CAAAAACACACCGTACAACAACTACATGAGTTACACGGAT
GATGACTGTACAAACCATTTTACACCCAATCAAGTAGCTC
GGATGCACTGCTACATTGATTTGGTCTACAAAACCTGGGT
CCATGAAAGAAAGCCCACCCCTGTTCCACTAGCACCAGTG
GTGGTTGGTCAAAAAGCGGACTCTGTCTCCATTCACTGGC
TGAATCCAATCAGTGGGCCGCTTGCCCACAGGGAGGGTGA
TATGAACTGCCAGCTCTGCGATGAGAATGGAGCTCTCCAT
CAATATGCCCATGAGGCCACTTCACCTCACGCTTGTGACT
CCACTGGATACTGGACGCCAGAAGAAGCAGTGGGGGCCCC
TGATGTGTACCAACCGTGTGAGCCCAGCATGCAGGCCTGG
AGTCCTGAAGTTAACCTGTATGAGCCCAACATGACGACAC
CGTGCCCCCAGAGCGAGGGCTGCGTACTGGAGCTGCATTT
CCTGCAGCCAGTGCTTCCTGACAGCCTGACCGTCTGGATC
ACCTACACCTCAGCCAACCAAAAAGCAATTGCCAATATTG
TGTTCATAACGGAGAATGGCGAGTTGATCCACACAGGTCC
TCAACATGCTTTCTGTGATATTCCTTTGACGCTCCATGTT
CACACTAGCAAGAAGGTCAAAGCCATTAAAATCTCCACCT
TTGACAAGAAGCTTGAGATAGATGCTGTTCTCCTGACCTC
GCGGCCCCAAAATCCCCTGTGCTCCGGCTGCCGACCACTT
CTTTACAGAGTCATCAGAGAACCACCAATCAGAGAAGACC
AGAGTCCTGCCATCGTCCGACAGCCCTCATACACAGACAG
CGATGTGCAGAAGGATGTTCAGTACCTGTACAGGATCCAG
GTGGAATCGGACGGTTTGTTCAGTGAACTTTCCCCCAGCC
TGCTTTACACTCACGGAGAACATTTCTGTGGTGATGCCAC
ACTACAGGGGACTGAGGATTGTGATGATGGAAATCTTTTA
GATGGAGATGGTTGTTCAAAAAAATGCCATGTTGAAGCAG
GTTTCAAGTGTCATGGTCAGCCAAGCCTGTGCTATGTGTT
TGAAGGAGATGGAGTGTGTGAGGAGTTTGAGAAGGGCTCC
AGCATCCAGGATTGTGGTTTTTTCACTCCTCAGGGGTTCA
ATGATCAGTGGGCGTCCACTGCCTTGGGCTCGCACCAGGA
CCAGAGGTGTCCTGCCTCCAGGGTCACCGGGGAGCCTGCG
CTCACTCAGATGTGCAAGTCACAGTATTTTGACATAAATG
AAATAGTGGCTCATGAGGCTTGGAGCCCCTGTACAGCCCA
TTATACACAGGATCAGTCTGTCTGGCTACAGGTAGGATTT
GAGCGGCCAGGTGTAGCAGCCTCTGTCATCATCTATCTGG
CATATGATGGTAGTTGGCATGGAGAAAACTGCAAGAAAAC
AGTGACCATTGAACTCTGTGACACCAATGGGAAAAGACAC
TTGCTTGGTTCGTATGAGGTGTCATGTCAGCGCAACCCCC
TAGTGGTGAATGTGACTCACAATCTGAGTGTGCCGTTTTA
CCAGACTTCAGCAGTGCAGCTGAACTTCTCCTCCTCTCAA
GTGGCCGTGGTGGCGGTTGCATTACGTACTTCTTGTCACT
TCAGCGCCTTTGCCCTGACCGGATGTGTGCGTAGGCTGTG
CAGTACTGAGTCATGCAGTCCTGTGAATATTGAACATGCT
TCAGTCCGCTGTACTCCAGCGTTAGACTCCAAACACTGCT
CTGTTTCCTGTCATCGTGGCTTTATACTCACTGTTCTCCA
CGGCCAGAGCCTTTCTTCCCATCAGAAGGAAGCAGAGCTG
ATTTGTGTGCATGGAGTGTGGGATCGTGTAGTGAGCTGTC
AGCCCGTTGATTGTGGTCCTCCTCCTCCATCTCATGTCTA
CTTTGCTTCCTTCTCCTGTCCCTGGGGCACTACATTCGGC
AAGCAGTGCACCTTTTCCTGTAACGCCCCGGCAATCCTGC
AAGGTGAGAGTGACACATTGGTTTGTCTTGAGGATGGACT
GTGGTCATACCCAGAAGCTTACTGCAAGATTGAGTGTGCG
GATCCACCTTTCCTACCAAATGCCACACTTCTAGTTCCTC
ATTGTCAAGGAGGCGGGCATGACGTGGGAACTGTTTGCCG
CTTCAAATGCAACCCAGGATATTATGTCACTGGGACTCTC
AACAAAAAGCCCAGAAAGAAGTTTCTGAGGTTGGAGTGTT
TGGAGGGTGGAACATGGCAAGAGGGCAGCTGTTCACCCGT
CACATGCCCTCCTCTACGACCAATGTTTGAGGGCATGTAC
TCATGCACCAACAATTTTGACTTTGATAGTGTCTGCACCT
TACAGTGTTCTGATCCAACAGAAAAGCCCAGCATTAGATG
CACCAAAGACGGCAGATGGACTGAGGACTTCACTATGTGT
AAGAAAATAGTGGGATCATGCCAGGCTCCTCCTGAAGTAA
ACCTGGTGGAATACAGCTGTGATGAAGGCTTTGACGTGGG
TGCAGCCTGTTACCCAACATGCATTGTGCCCTTGAGTGAC
CCTGTGGTTTTAGCCAATGGCTCCAGCGCTGATACAGTAG
AGCACTGGATGGTTCCAACCAAAGTTCAGAGTATTGTCTG
CACTGGGATGTTGAAGTGGTATCCGAATCCGGAGCAGATC
CACTGCATTCAGTCCTGTGAGCCATTTGGTGGAGACGGTT
GGTGTGACACCATTAACAACCGAGCGTATTGCCAATATGA
TGGAGGAGACTGCTGTCCATCTACCCTCTCATCTGGAAAG
GTCATTCAGTTCGGGGTGGACTGCGATCAGGATGAATGCA
CCTGCCGTGACCCTGAGGCTGGCGAGAACAAGCCAAAGGA
GAAGCAGCAGCCGGGAGCTCCGTGAGGCACAGAGAGAGAG
AGAGCCAGGCTGATCAAAGGCCATCATTACAACCATTAAA
CTGCATCAATACAATCCTCTCCAACGCTAATCTATAAAGT
AACACCTAATATATTTTTCAGAAGCTCTAACATAGATGTA
GATGTAGTTTCGACCATATTTTAGCCCGTTTGCGTAGCTA
CACCATTGATTTTTTTTTTTATAACTATTTTATACAAATA
GTTTTTGCTTGTTGTGAGGCACATTCTTCATATTGTATGT
CGTTAATATAAACATGCTTATTTCAGACTGTCATTTCAAG
CAGAATTCTGGATCTTTGTTTTATTTTATTCCCTCTGTAT
GTACATGCAAACCCTGTGAAACGCATGTGCGCTTTGGGAA
ATGACAGTTCCTTTATAGCAGTTGTAATGGAAATATATGA
CACTATTTTTGTATGCTGTTCTGTCTGTTCAATTGTAGTT
TCACTGTCATATCAATAAAGTATAAGTACACGGTGGTAAA
GACACAA

pappa2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pappa2-201 6727
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pappa2-201 Contained in:

OTHER pappa2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032695 (1)
  • Ensembl_Trans:ENSDART00000111730 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB933315 (1) 553 bp
    CITATIONS (2)