ZFIN ID: ZDB-TSCRIPT-090929-13929
Transcript Name: vsx2-201
Previous Name: vsx2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032520 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032520|OTTDARG00000024821|ZDB-GENE-001222-1 vsx2|OTTDARP00000026336 chx10-001 LG_ CR628322.5 Danio rerio protein_coding KNOWN, 1720 bp
GGATCATGCGTATTGCGCCTCGGATGCCTGTGCACAGGGG
ACCGACTCGAAAGCAAAGAAGGGAATAGTCTCAGAGGCAC
AATGACAGGAAAGGATGGGGCTGTTTTGTCGGAAAGTTTG
AACAAATCAAAATCGCTGTGTGCCACCGAGAACGGGGGAA
ATAACAATCCACATCTGTCAAAGAGCAGCATCACACATCC
GCCAAAATGCACGGGTTTCGGCATTCAGGAGATCTTGGGA
CTAAATAAAGAGCCGTCCTCGGCCCCACGGAGCACACTGG
ACTCCTTCCCCGCCGGGGCGCACCTTCTGGCCAGCAGGTC
GATGCTCGGTCCGGCTGGTGTCGGTGTTGGGGTCGGGATG
GGATTAATTGGGCCTGGAGGTATTCCGTCTTTCTACAGTC
AGCCCGCGTTTCTGGAGGTTCTGTCAGACGCGCAGAACGT
GCACCTCCAGCCGCTCAGCAGGACGGTGGGGCCGCTGGAA
CATAACCAGTCTGCCAGCTCAGATTCAGATGATGTCTCTT
CAAGTGAAAGGAAAATGTCAAAGTCTTCACTGAGCCAGAG
CAAGAAGAGAAAAAAGAGACGACACAGAACAATATTTACA
TCTTACCAGCTGGAAGAACTGGAGAAAGCTTTTAACGAGG
CTCATTATCCGGATGTGTACGCCAGAGAAATGCTGGCCAT
GAAAACCGAGCTGCCGGAGGACAGAATACAGGTGTGGTTT
CAAAACCGGAGGGCCAAGTGGAGGAAGCGGGAGAAGTGTT
GGGGTCGCAGTAGCGTGATGGCGGAATACGGGCTCTACGG
CGCCATGGTGCGTCACTCTATCCCTCTGCCCGAGTCTATA
CTCAAATCTGCTAAAGATGGCATCATGGACTCCTGTGCCC
CCTGGCTTCTAGGGATGCACAAGAAGTCCTTGGAGACGGC
TGGGCACCAATCAAACGAGAAGTCAGATGTCACTCAGACA
CCGACCAATCCCAAACCGGACGAGGCCGAGGCTGAGGAAA
GGAGGACAGAGTCACCAATGTCCAAAGAGGAACTGAGGGA
GAACAGCATTGCTGCTCTCAGGGCAAAAGCGCAGGAGCAC
AGCGCCAAAGTGCTTGGAACAGTTTCCTCAGAGAGACTAG
AGCATAACATGGAGACAACGGTGACAGAGGAGAAGTCCAG
CGAACAGATAGACGCAAAAGAAGAGGAAAAGAGCTCTTAG
ATCTTGCACTGTAACAGCATAAAGCGTAGAAAATGTCTGG
GCTGTTTTCTCATCCTCAACACTGGACTTTTAATTCTTCA
CTTTAGCAGGTCAGCAGCATTTAGAAATGTACAGTATTTT
GATAGTAGCATTGGTTCATCCATGCAACAGGTTGATAGCC
TTTTTTAAACAGAGGCCTACAAAAATCTCAGCCATAACTT
CTTTTTAAGATCCTAGTTTTCAGTCACTTTTGTTATGAGC
CATGTATAGATCATCATTTAAATGAAGAATTAGAAATGTA
TGAGACTGAACAACATTTGTTTTGAGCATCTGAGATTGAG
TTACAGCAGCTGCTTCAGTATTTCAATCACTTAAAAACAC
TTGACTTGGGCTTGTGCGTTAAAGACAGTTATATTAATAG
ATTTAATTTAATATATACACCTTACTCAATAAAACCACAA
AGCACATTGTAATAAGCCATTCTATTCCATTCTAAGCCAG
TTCTATTAGGTTTTTCCCTAAAATGAAAATGTACTCAGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vsx2-201 Contained in:
OTHER vsx2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032520 (1)
  • Ensembl_Trans:ENSDART00000030448 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055588 (1) 1727bp
    GenBank:BC067664 (1) 1697bp
    GenBank:EH584470 (1) 957bp
    GenBank:CK354355 (1) 585bp
    CITATIONS (2)