header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1387
Transcript Name: igf1-201
Previous Name: igf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009112 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009112|OTTDARG00000008005|ZDB-GENE-010607-2 igf1|OTTDARP00000007852 igf1-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 1237 bp
GAGAAGGCAAATGCTGCCCCAGCTGTTTCCTGTTGAAAAT
GTCTCTGTAATGTAGATAAATGTGAGGGATTTTCTCTCCA
AATCCGTCTCCTGTTCGCTAAATCTCACTTCTCCACAACG
AGCCTGCGCAATGGAACAAAGTCGGAATATTGAGATGTGA
CATTGCCCGCATCTCATCCTCTTTCTCGCTTTTTAATGAC
TTCAAACAAGTTCATTTTTGCTGGGCTTTTGCTGGAGACC
CAAAGGGATGTCTAGCGGTCATTTCTTCCAGGGGCATTGG
TGTGATGTCTTTAAGTGTACCATGCGCTGTCTCCCGAGTA
CCCACACCCTCTCACTGGTGCTGTGCGTCCTCGCGTTGAC
TCCCGCGACTCTGGAGGCGGGGCCGGAGACGCTGTGCGGG
GCGGAGCTTGTAGACACGCTGCAGTTTGTGTGTGGAGACA
GGGGCTTTTATTTCAGCAAACCGACAGGATATGGACCTAG
TTCAAGAAGGTCACACAACCGTGGCATCGTGGACGAATGC
TGCTTTCAAAGCTGTGAGCTACGGCGCCTCGAGATGTATT
GTGCGCCTGTGAAGACAGGCAAATCTCCACGATCTCTACG
AGCACAACGACACACAGATATTCCCAGGACACCAAAGAAA
CCTATATCTGGGCATAGCCACTCTTCCTGTAAGGAGGTTC
ATCAGAAGAACTCGAGCCGAGGAAACACAGGGGGCAGAAA
CTATCGCATGTAGAGGACAGCGGGAGGAATGAACTGAGAG
AGACAAGAGAAACCGTTGGACAGCCGAAAAAAAGAGGGGA
AGAAAGAAAGACTGGTTTTCTAGGAATGTGCTCCATTGCA
CTGTATTAAACTAAACAAACAAGCAAACAAAAAAGATACT
GGACGTTTAAGCCCCATCTTAAGACAAACAAATCTGATGA
TTTCCATACACTGCACCAATACATACTGGTGAAAAAACAA
AATTAGCTGCTATAAAAAGTCAACAATTTATCCTCCTTGT
GTGAACTGTTACACTGAATGGATGGTGAAAGCTTTTTATA
GTGGCAGTGCCCAAATATTGACCCTACTCTAGTTCTAAGG
TTCATATTACACTGAATTCTGATGGACTGATACTGGAACT
GAGGTAATAGGTGACTATTGGAGAATTTAATCGTCCCCAC
TCTTGTAAAGCTTATCACAATCCGGATCGAGCAGAAGAAA
GTTGCAATATTTTACCTTGCAAACAAACTTTGTGGGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
igf1-201 Contained in:

OTHER igf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009112 (1)
  • Ensembl_Trans:ENSDART00000004717 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF314545 (1) 654 bp
    GenBank:BF717691 (1) 523 bp
    GenBank:BG738468 (1) 523 bp
    CITATIONS (2)