header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13715
Transcript Name: colec12-201
Previous Names: colec12-001, si:ch211-212m21.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032178 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032178|OTTDARG00000024571|ZDB-GENE-030131-9807 colec12|OTTDARP00000026110 CH211-212M21.5-001 LG_ BX927088.11 Danio rerio protein_coding NOVEL, 4850 bp
AGAGCTTCAGTAAAGCACTGTGGTGCTGCGGCTGCTGCTG
CTTTCACCTGGTTTTTCTTTAAGATATTCAGCCCAAGAAG
AAAACAAGTGAACTAACAGACACCCTGCGGACTGCCAGCT
TCTCTCTGGTTCTCGGGTTGCAGCCAGCAGGCAGAAGAGG
ACGCATCCTCATTCACCTCAAGTGGATTTCCATCGTGAAC
ACGCTCTCATGGAGGGAGAGAAAAAGTGTGCGCACTGAGC
AGAAGTTTGTTGAACATTGTTCGCGAATTGTTCCTGTAGT
TTTACAAGCTAAGCACCAGTCATAGGGATTGAAAAGACCC
TACGCATGTTTCAGGTGGAATATTAGTGAAAGTTCAGCGC
TTATTCTTGGGTCTGCGCGTTGACATGAGATTGATGTGAA
GGTTTGGCTCGTGACGGAACGGTGCACCTCAGTTTGACCA
CGATGAAGGACGACTTCAATGATGAAGAAGAAGTGCAGTC
ATTTGGCTACAAAAGGTTTGGTATCCAGGAAGGAAATGAA
TGCACTAAATGTAAAAACGACTGGGCCCTGAGGGTGGCGA
TTGCACTTCTGTATGTGCTTTGTGCACTGCTCACCATAGC
TGTGGCTGTGCTGGGATACAAAGTGGTCCAGAGGATGGAT
AATGTAACAGAGGGTATGCAAAATTATGGAGGGAAAATCA
CGGCTGTAGAGACTGATCTTAAGAAACTTGATGATCAAAC
GGGAGAGAAGTCAGAAAATGCTACCAGTGAACTTCACTCA
TTCAAGTTGGAATTTCAGACATTGCAGAAGCAGCTCAGCG
ACGTTATTGTGAAGACTTCCAACAACAGAGCTGTTCTCAA
AGAGCTACAGCTAGCTGGTGAGGACATGCAGAGTGGACAT
CTCTCGCTGCGAGACCTGCTGGAGAGCAATGCCAATGTCA
TCAGCAAAGTAAACCACACTTTGAACACATACAACAGTCT
GATTGATGGATTAAAAACAGAAACGGCGAGACTCCAGTCA
GATCTCCATGTACAGACAAGTGAACAGGGCCAAAACAGCC
ACAGCATCAGCACTCTAAACTTTACCCAGACCCAGCAGAG
GAACCTCATCAGCTCCCTCCAGAGATCAGTGGAGGACACT
GGCCAGGCTGTGCAGAAGCTTAAGAATGACTATCAGAGCC
TCCAGCAGGTGGCTAGGCAAACCAAAGCAGATGCTGATTG
GCTGAGAGAGAAGGTGCAGAACCTTCAGGCTTTAGCGGCT
AATAATTCTCTGCTGACTCGCTCTAACAGTGACTCTCTAG
AGGACGTAACCTCTCAGTTAACCACACTGTCAGAGCAGGT
CCAGAACACTTCGACCATCACTGACAGCCATGATCAGAGC
CTGCGTGAGCTCATGGACCAGCAGCGAGATCATGATAATG
CCACCTCCATTAGATTTGATGCATTAGAGGCACGTCTTGA
CAGCAATGAGGGGGAAATGGACCGCATAACAGGGAATGTT
AGCTTTACCACGCAGCTGCTCAGAGCGATCAGTACAGACT
TGAATGGTCTGCGCACGTGCTCTGAGACGGTGACCCGACA
CTCAGAACTGCTGCATGGGCTCAACAACAGTGTGGCTGAA
ACCAGGGCAGAAAGCACAGAGCTCAAAGCCCAGCAGGAGG
AACTCGCTGTCAGGCTTGACAAAGAGGTCAGCAGCCTTTC
CATAGTTATGGATGAAATGAAACTGGTTGACAACAAACAC
TCGCAGCTCATCACAAACTTCACCATCCTTCAGGGTCCTC
CTGGTCCAAGGGGTCCTCGGGGAGATAAAGGGTCCATGGG
GCTACCTGGTAAAACTGGCCCGAAAGGTGAAAAGGGTGAA
AAAGGAGCACCTGGTGATGCTGGACCTAAAGGAGAAAAGG
GTCCAGCGGGACCTCCTGGTGTGCCAGGGTTGAAAGGGCC
ACCTGGATCAAGAGGAAGCCCTGGGCCAAAGGGTTCACGA
GGATCTGGGGGCAGGCAAGGGCCTTCAGGGGAGAAAGGTG
ACCCTGGGATACCTGGTATGCCTGGAAGAGATGGTCAGCC
TGGTCCTACTGGCCCACAAGGGCCACAGGGACTCAGAGGT
CCAGCTGGACCTGCAGGACTAGAAGGAGCCCGTGGACCCG
TAGGCCCCATTGGCCCACCAGGACCACCTGGATTACCAGG
ACTTCCTGCACCACCAATAGTTGTGCCACCAGTAGATCCA
CAAGGCTTTGTCAACCGCCAGGTAGCGCCGCCACCAACAA
CTACACCAGGATGTCCCCCTCAGTGGAAGGGCTTCAGAGA
GCAATGCTATCACTTCTCAGCTCCAATGGAGAGTCTGAAC
TTTGATGAAGCCAAGGAAAGATGCAGCAACTTGAGTTCAT
CTATGCTGATTATCAATGATGAAGAAGAGCAGCTATGGAT
AAAGAGGCAGATTTCTGGAAAAGGCTACTTTTGGCTGGGC
CTAAAATGGAAACCTGGTCAGCCTGATAACTGGAGCCATG
GTCATGAAGCTGGTGAGGACTGCGCAGGGTTGATACACGA
GGCCAGTTGGAATGACTTTTTCTGCACAGAACGCATTGGT
TTTATTTGTGAACGAACTAATGAATCCAAAGTTCCAGTTT
TATAGCATCTGTTGAATGAATGAAAAGAGAATATGATATG
ACAATCATAAAGACACTTGAGAAGGTTTCTGTCACAGTAT
CCTCTCGCTTTGGCCAGAGTGCAACATACAGTACGTGATA
AACTCAAAAGTAAAGTCATCGACAATCACGACCAAGTCAA
TACTGCAAACTACACAAAAAACACTGATCACCAGTCACGT
TAATGTTTAGATAAGTGAAAAGGCTGTAATGTATTGTAAT
CGTGTGACTGTAAATACCTGTCTTCCCTGTGTCATTAACA
AAGCTGATGCCACATTACTCCAGTGCAATACAATGAAGCT
TTGTAGCTGCTTTAATTGAAATGAAGCTTTGAACAGCCGA
GCATAACGCTACAGTTAATATGTTTTAATGACTATAATCC
AAAAATCGTTCACAACAGAGTTTTATATCATAAGTCTTGG
AACATCATTGATGTGATTTTATATTAAAAAAATTGATAAG
GTTTTGAATTTTTGAAATATTTGATTACGCAGTAGCTATG
TATAAAATAGTTGTGTATTTGAACACATGTACATGTATGT
AGTCATGATCAAAGACCATGTTTTTATCTGAAATAAAATA
TAGTAGGTATTTTTCAATATGCTTTTGACATTTTATCAGT
ATGTCTAAATGTGGAATGCAATGTCTGTGTTCAATACTTA
TTTCAATCACACATACATTATGCATATACCGATTTTACAG
TATGTGTTTATACTGTGTTTACTGTGACAGTGTAACAATA
ACTTGTATCTATTGATTAGTAATTTTGTCAGACATATTTA
GAATAAGAATCAGTTGACTGTATTTTGATTGAATATTTCC
TAAAAAAAAAAAAAAGTTATTGTAAACTATAATATTAATA
ATAAGATAAATACACTCACCGGCCACTTTATTAGGTACGC
CTGTCCAACTGCTCATTAATGCAAAATTCTAATCAGCCAG
TCATATGGCAGCAACTCAATGCATTTAGGCATGTAGACAT
GGTCAAGACGAGTTCAAGCAGTTCAAACAGCATCAGAATG
GGGAAGAAAGGGGATTAAAGTGACTCTGAATGTGGCATGT
TTGTTGGTTCCAGATGGGCTGGTCTGAGTATTTCAGAAAC
TGCTGATCTACTGAGATTTTCAAGCACAACCGTCTCTAGG
GTTTACAGAGAATAGTCAGAAAAAGAGAAAATACCCAGTG
AGCGACAGTTCTGTGGTCGCAAATGCCTTGTTGATTCCAG
AGGAAAATGGCCAGACTGGTTTAAGCTGATAGAAAGGCAA
CAGTAACTCAAATAATCACTCATTACAACTGAGGTATGCA
GAAGAGCATCTCTGAATGCACAAAACCTCAAACCTTGAGG
CAGATGGGCAACAGCAGTAGAAGACCACACCAAAGGTGCC
ACTCCTGTCAGCTAACAACAGGAAACTGAGGCTATTCACA
CAGGCTCACCAAAATTGGACAACAGAAGATTGGAAAAACA
TTGCCTGGTCTGATGAGTCTTGATTTCTGCTGCGACATTC
AGGTGGTAGGGTCAGAATTTACCAATTGAGGATCATGTCA
ACGCCACAGCCTACCTCAGTATTGTTGCTCACCATGTCCA
TCCCTTTCGCAGTGTACCCATCTTCTGATGGTTACTTCCA
GCAGGATAACGCACCATGACATAAAGCTTGAATCATCTAA
GACTGGTTTCTTGAACATGACAATGAGTTAACTGTACACA
AATGGCCTCCACAATCACCAGATATCAGTCCAATAGAGCA
CATTTGGGATGTGGTGAAGATTCGCATCATGTATGTGCAG
CTGACAGATCTGCAGCAACTGAGTGATGCTATCATGTCAA
TATGGACCAAAATCTCAGAGAAATATTTCCAGTAGCTTGT
TGAATCTATGCCATGAAGGATCAAGGCAATTCTGAAGGGA
AAAGGAGGTCTAACCCGGTAGTAAGGTGTACCTAATAAAG
TGGCTGGTAAGTGTACATTATGCATTTACCAGTTTTGCAG
TATGTGTTTATATATTTTTTGTCTAAGCACAAATATTATC
CATAATCATTTATACTGATTTAGTCAAAATGCCCAATGTG
ACAGTGTAACAATAAATTGTATCTAATAATTTAGTAATCT
TGTCAGACATGTTTAGAACAAGAATCAGTTGATTGAATTT
TAATTTAATATTGTTGCTAATAAAAAGTGAATAATAAACT
ATAATTGATTCATTAGTTGTATTAATAATAAGACATATAG
ATAGTTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
colec12-201 Contained in:
OTHER colec12-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032178 (1)
  • Ensembl_Trans:ENSDART00000086863 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124303 (1) 2114bp
    GenBank:CT667541 (1) 759bp
    GenBank:DN892642 (1) 755bp
    GenBank:CT590780 (1) 638bp
    GenBank:CT598682 (1) 580bp
    GenBank:EB870856 (1) 488bp
    CITATIONS (2)