ZFIN ID: ZDB-TSCRIPT-090929-13714
Transcript Name: clul1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032177 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032177|OTTDARG00000024570|ZDB-GENE-031118-57 clul1|OTTDARP00000026109 CH211-212M21.4-002 LG_ BX927088.11 Danio rerio protein_coding NOVEL, 727 bp
TCAATCACACAAGACATCAAGCGGACATTTCTGGCTTTAT
TATTCCTTTGAGATTACCAAAGATGGTGAGGATGAGGGTG
TTGATCTTCTCTCTGGTTTTCCTGGCGTCTCTGGGCGTCT
TCCATTGTGCTCCTGAAACGTCCCTTCCTCCAGTATTACC
CAACACCCTCAAACGTCTGTCTCTGGAGGGAGAGAAGCTG
GTGGATCAGGAGGTCAGCAAAGCTCTGTATGGAATCAAAC
AAATGAAGGAGGTGATGGCCAGAAATGAAGAGAAACATGC
AAACCTAATGAAGTCCCTGAGGCACAGCGAGGAGAAGAAA
AAGGGGGCAGCAGAGATCACGCAGAGCATAGAACAGAAGC
TGAATGAAGCAGCGCAACACTGTAACGAGTCTATCAAGTC
CTCGTGGCTGCAGTGTCTGCACTGTCTCAACGACACCTGC
AAAACCTTCTACACCAACAACTGCCGTCGTGGATTCACCA
CTTTCACTAACAAACTACAGACCTTCTTCCAGAGACTGAA
CTCTCAGTTTGAGCCTCGTGATGCTCAGGATGAGGTGGCT
CTGAACCAGAGCGTTGAGACTCCTGACCTGCAGGTGGTGA
GGATCGAGGACTCCTTTAGCAGCCTTCTCTCTAAAGTGGG
AGCGCTGGTAAATCGCAGTGTGGTGCTGGTCTCTCACTTC
CACCATGAGCTAGACCAGGCCTTGCGTAGAGCCTTCAGCC
CTGAGCT

clul1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA clul1-001 (1) 2055
clul1-002 727
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clul1-002 Contained in:
OTHER clul1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000032177 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN857750 (1) 718bp
    GenBank:BG738476 (1) 350bp
    CITATIONS (1)